Papaver dubium
speciesAt a glance
Occurrence records133 700
Data sources12
Biological traits70
DNA specimens30
eDNA detections16
Sources12 archives
Databases and archives Papaver dubium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility133 700 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics30 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources70 traits
Chemical compositionLOTUS26 compounds
Occurrence & distributionGBIF133 700 records
Environmental DNA1 datasets · 6 countries16 detections
DNA & barcodingBOLD · NCBI30 specimens
Genome at a glanceCCDB · GoaT3.9 Gbp
01Narrative
Papaver dubium, le Pavot douteux, aussi nommé Petit coquelicot ou Coquelicot douteux, est une espèce de plantes à fleurs de la famille des Papavéracées originaire de la région méditerranéenne. C'est un cousin du pavot somnifère, mais surtout proche du Coquelicot, qui croît en Europe dans les terres meubles et les anciennes friches.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology28
Fruit length20 mm
Fruit length max20 mm
Fruit length min9 mm
Fruit width7 mm
⚠ sources differ — AusTraits: 7 mm · GIFT: 8 mm
Fruit width max9 mm
Fruit width min4 mm
Leaf length145 mm
Leaf length max150 mm
Leaf length min20 mm
Leaf mass183 mg
Leaf size4 628 mm²
Leaf width45 mm
Leaf width max50 mm
Leaf width min2 mm
Petiole length2.25 cm
Plant height0.362 m
⚠ sources differ — GIFT: 0.362 m · AusTraits: 0.7 m · LEDA: 0.4 m · TRY: 0.31 m
Plant height generative0.45 m
Plant height max1 m
Plant height min0.2 m
Seed length0.665 mm
Seed length max0.7 mm
Seed length min0.7 mm
Seed mass0.127 mg
⚠ sources differ — TRY: 0.127 mg · LEDA: 0.12 mg · GIFT: 0.117 mg
Seed mass max0.14 mg
Seed mass min0.09 mg
Seed volume0.099 mm³
Seed volume max0.099 mm³
Seed volume min0.099 mm³
Life cycle & reproduction19
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flower colourblack
Flower width max60 mm
Flower width min20 mm
Flowering endAug
Flowering startMay
Flowering timennnnnnnnnnyn
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number18 000
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTcrop fields, mountains, old fields, roadsides, stony places
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate linear oblanceolate
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)163 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)17.3 mm²/mg
⚠ sources differ — TRY: 17.3 mm²/mg · LEDA: 22.5 mm²/mg · GIFT: 23.99 mm²/mg
Other traits2
Diaspore typegerminule
Seeds per fruit>1000
03Chemical composition26 compounds
Compounds documented for Papaver dubium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Aporphine alkaloids $ Isoquinoline alkaloids6
Isoquinoline alkaloids $ Protoberberine alkaloids5
Isoquinoline alkaloids5
Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids4
Isoquinoline alkaloids $ Phthalide derivatives $ Tetrahydroisoquinoline alkaloids2
Documented compounds26 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Corytuberine | present | LOTUS | |
| (+-)-Stylopine | present | LOTUS | |
| (-)-Mecambrine | present | LOTUS | |
| (12R)-11-methylspiro[3,5-dioxa-11-azatetracyclo[6.6.1.02,6.012,15]pentadeca-1(15),2(6),7-triene-14,4'-cyclohexa-2,5-diene]-1'-one | present | LOTUS | |
| (1R,14R,24S)-13-methyl-5,7,19,21,25-pentaoxa-13-azahexacyclo[12.11.0.02,10.04,8.015,23.018,22]pentacosa-2,4(8),9,15(23),16,18(22)-hexaen-24-ol | present | LOTUS | |
| (1R,14S,24R)-24-ethoxy-13-methyl-5,7,19,21,25-pentaoxa-13-azahexacyclo[12.11.0.02,10.04,8.015,23.018,22]pentacosa-2,4(8),9,15(23),16,18(22)-hexaene | present | LOTUS | |
| (1R,14S,24R)-24-methoxy-13-methyl-5,7,19,21,25-pentaoxa-13-azahexacyclo[12.11.0.02,10.04,8.015,23.018,22]pentacosa-2,4(8),9,15(23),16,18(22)-hexaene | present | LOTUS | |
| (2'aS)-2'a,3',4',5'-Tetrahydro-3'-methylspiro(2,5-cyclohexadiene-1,1'(2'H)-cyclopenta(ij)(1,3)dioxolo(4,5-g)isoquinolin)-4-one | present | LOTUS | |
| (5bR,13bR,15S)-5b,6,7,8,13b,15-Hexahydro-15-methoxy-6-methyl(1,3)dioxolo(4,5-h)-1,3-dioxolo(7,8)(2)benzopyrano(3,4-a)(3)benzazepine | present | LOTUS | |
| (S)-Corydine | present | LOTUS |
05DNA & barcoding30 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Papaver dubium has left across the world's sequence archives.
At a glance
DNA specimens30
Marker genes6
GenBank sequences10
eDNA detections16
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCCAAGCCTTCGGGCCGAGGGCACGCTTGCCTGGGCGTCACGCACC …
Papaver dubium voucher 33812HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Papaver dubium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 882 660 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Papaver dubium3.88 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–422n range28median28mode101records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2847×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Murín A. & Májovský J., 1992: Karyological study of the Slovak flora XXV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 53-57.
CCDB · slov-fl — Kubát K., 1980b: Bemerkungen zu einigen tschechoslowakischen Arten der Gattung Papaver. - Preslia 52: 103-115.
CCDB · slov-fl — Kubát K., 2007: [New records in Papaver], pp. 427, 428. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · slov-fl — Koopmans A., 1970: Species differentiation in Papaver dubium. - New Phytol. 69: 1121-1130.
CCDB · brit-fl — Humphreys, M.O. New Phytol. 74: 485-493 (1975)
CCDB · brit-fl — McNaughton, H. Annual Rep. Scott. Pl. Breed. Sta. 1960: 76-84 (1960)
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 15-17. Garca, I.Lagascalia7(2): 199-201(1977).
CCDB · fl-europaea — McNaughton , 1960
CCDB · ipcn-api-dl — Majovsky, J. & A. Uhrikova. 1982. Karyotaxonomisches Studium einiger arten der flora der Slowakei. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 29: 97–102.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Kubat, K. 1980. Bemerkungen zu einigen tschechoslowakischen Arten der Gattung Papaver. Preslia 52: 103–115.
CCDB · ipcn-api-dl — Murín, A. & J. Májovský. 1992. Karyological study of the Slovak flora XXV. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 39: 53–57.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Klapproth, H. & J. W. Kadereit. 1995. Variability of isozyme pattern, chromosome number, and latex colour and components in the closely related Papaver dubium L. and P. lecoqii Lamotte in C Europe. Flora 190: 97–104.
CCDB · ipcn-api-dl — Stoeva, M. P. 1987. Chromosome numbers of Bulgarian angiosperms. Fitologija 33: 65–66.
CCDB · ipcn-api-dl — Bahl, J. R. & B. R. Tyagi. 1989. Karyoptype analysis of Papaver dubium L. Curr. Sci. 58: 1384–1385.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Stoeva, M. P. 1991. Karyological study of the Bulgarian representatives of the genus Papaver L. sect. Orthorhoeades Fedde. Fitologija 40: 40–55.
CCDB · ipcn-api-dl — Lambrou, M. 1994. <In> E. Hörandl, Systematik und Verbreitung von Papaver dubium L. s.l. in österreich. Linzer Biol. Beitr. 26(1): 407–435.
CCDB · ipcn-api-dl — Dobes, C. 1994. <In> E. Hörandl, Systematik und Verbreitung von Papaver dubium L. s.l. in österreich. Linzer Biol. Beitr. 26(1): 407–435.
CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn75-78 — Uhrikova & Majovsky 1978
CCDB · book-ipcn75-78 — Koktay 1978
CCDB · book-ipcn75-78 — Garcia 1978
CCDB · book-ipcn75-78 — Kubat 1978
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-fedorov — Ljungdahl 1922
CCDB · book-fedorov — Tischler 1934
CCDB · book-atlas-flowering-plants — Ljungdahl 1922
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
CCDB · CromoCat 2015 — Bahl, J. R. & Tyagi, B. R. (1989). Karyoptype analysis of Papaver dubium L. Current Science 58: 1384-1385
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — García, I. (1977). Números cromosómicos para la flora española, 15-17. Lagascalia 7(2): 199-201.
CCDB · CromoCat 2015 — Koktay, P. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 522.
CCDB · CromoCat 2015 — Koopmans, A. (1970). Species differentiation in Papaver dubium. New Phytol. 69: 1121-1130.
CCDB · CromoCat 2015 — Stoeva, M. P. (1987a). Chromosome numbers of Bulgarian Angiosperms. Fitologija 33: 65-66.
+2 more references
2n 4244×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Kubát K., 1980a: Papaver dubium agg. v Československu, pp. 185-188. - In: Hindák F. (ed.), Zborník referátov z III. zjazdu Slovenskej botanickej spoločnosti pri SAV. Zvolen, 30. 6. - 5. 7. 1980. SBS pri SAV, Bratislava, VŠLD, Zvolen.
CCDB · brit-fl — McNaughton, H. Annual Rep. Scott. Pl. Breed. Sta. 1960: 76-84 (1960)
CCDB · brit-fl — Koopmans, A. New Phytol. 69: 1121-1130 (1970)
CCDB · fl-europaea — LOvkvist, 1963
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · ipcn-api-dl — Klapproth, H. & J. W. Kadereit. 1995. Variability of isozyme pattern, chromosome number, and latex colour and components in the closely related Papaver dubium L. and P. lecoqii Lamotte in C Europe. Flora 190: 97–104.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Kubat, K. 1980. Bemerkungen zu einigen tschechoslowakischen Arten der Gattung Papaver. Preslia 52: 103–115.
CCDB · ipcn-api-dl — López Pacheco, M. J., R. A. Redondo, A. F. Rodríguez, J. I. A. Felpete, C. A. Casado & E. P. Garcia. 2002. Números cromosomáticos de plantas occidentales, 910--920. Anales Jard. Bot. Madrid 59(2): 287.
CCDB · ipcn-api-dl — Kadereit, J. W. 1988. A revision of Papaver L. section Rhoeadium Spach. Notes Roy. Bot. Gard. Edinburgh 45(2): 225–286.
CCDB · ipcn-api-dl — Lambrou, M. 1994. <In> E. Hörandl, Systematik und Verbreitung von Papaver dubium L. s.l. in österreich. Linzer Biol. Beitr. 26(1): 407–435.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Runemark, H. 2000. Mediterranean chromosome number reports 10 (1110--1188). Fl. Medit. 10: 386–402.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1966.' Chromosome numbers of flowering plants in the Netherlands II. Proc. Roy. Neth. Acad. Sci. Ser. C. 69: 541-556.
CCDB · book-ipcn75-78 — Skalinska et al. 1974
CCDB · book-ipcn75-78 — Kubat 1978
CCDB · book-fedorov — Sugiura 1937a
CCDB · book-fedorov — Love A., Love D. 1944b
CCDB · book-fedorov — McNaughton, Harper 1960
CCDB · book-fedorov — Heimburger C.
CCDB · book-fedorov — Gadella, Kliphuis 1966
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1966). Chromosome numbers of flowering plants in the Netherlands II. Proc. Kon. Ned. Akad. Wetensch. Ser. C 69(5): 541-556.
CCDB · CromoCat 2015 — García, I. (1978). In Numeros cromosomicos para la flora Esparhola. 1-44. Lagascalia 7: 191-216.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Klapproth, H. & Kadereit, J. W. (1995). Variability of isozyme pattern, chromosome number, and latex colour and components in the closely related Papaver dubium L. and P. lecoqii Lamotte in C Europe Flora 190: 97-104
CCDB · CromoCat 2015 — Koopmans, A. (1970). Species differentiation in Papaver dubium. New Phytol. 69: 1121-1130.
CCDB · CromoCat 2015 — Kubát, K. (1980). Bemerkungen zu einigen tschechoslowakischen Arten der Gattung Papaver. Preslia 52: 103-115.
CCDB · CromoCat 2015 — López Pacheco & al. (2001). Números cromosomáticos de plantas occidentales, 910-920. Anales Jard. Bot. Madrid 59(2): 287.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1944b). Cytotaxonomical studies on boreal plants. III. Some new chromosome numbers of Scandinavian plants. Arkiv. for Bot. Band 314(12): 1-22.
CCDB · CromoCat 2015 — McNaughton, I. H. (1960). Internal breeding barriers in Pappaver. Ann. Rep. Scott. Pl. Breed. Sta. 190: 76-84.
CCDB · CromoCat 2015 — Mesí?ek, J. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesícek & V. Javurková-Jarolímová. Academia, Praha NONE LISTED
CCDB · CromoCat 2015 — Queirós, M. (1980b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XVII. Papaveraceae. Bol. Soc. Brot. 54: 153-171.
CCDB · CromoCat 2015 — Sugiura, T. (1936b). A list of chromosome numbers in Angiospermous plants. II. Proc. Imp. Acad. Tokyo 12(5): 144-146.
CCDB · CromoCat 2015 — Sugiura, T. (1937b). Studies on the chromosome numbers in higher plants, with special reference to cytokinesis. II. Cytologia Fujii Jub.(2): 845-849.
+2 more references
2n 1410×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov +2
CCDB · ipcn-api-dl — Magulaev, A. J. 1979a. The chromosome numbers of flowering plants in the Northern Caucasus. Part 3. Flora of the North Caucasus and questions of its history,. 3: 101–106.
CCDB · ipcn-api-dl — Baytop, A. & M. Saraçoğlu. 1982. Türkiye'nin tek yillik Papaver türleri. Türkiye'nin Papaver türleri üzerinde aras|7tirmalar (Prof. Sarim Çelebioğlu'nun Dr. Phil. ünvanini alis|7inin 50. yildöonümü nedeniyle Istanbul Üniversitesi Eczacilik Fakültesinde yapilan bilimsel toplanti) 28--32.
CCDB · ipcn-api-dl — Stoeva, M. P. 1984. Chromosome Number Reports LXXXV. Taxon 33: 756–760.
CCDB · ipcn-api-dl — Stoeva, M. P. 1991. Karyological study of the Bulgarian representatives of the genus Papaver L. sect. Orthorhoeades Fedde. Fitologija 40: 40–55.
CCDB · book-ipcn67-71 — KAWATANI, T., & T. OHNO. 1965. Chromosome numbers in Papaver. Bull. Nat. Inst. Hyg. Sci. 83: 127-133.
CCDB · book-fedorov — Sugiura 1936a
CCDB · kew — Srivastava S, Lavania UC. 1991. Evolutionary DNA variation in Papaver. Genome 34: 763-768.
CCDB · CromoCat 2015 — García, I. (1978). In Numeros cromosomicos para la flora Esparhola. 1-44. Lagascalia 7: 191-216.
CCDB · CromoCat 2015 — Magulaev, A. Y. (1979). The chromosome numbers of flowering plants in the Northern Caucasus. Part 3. Flora of the North Caucasus and questions of its history. Willdenowia 3: 101-106.
CCDB · CromoCat 2015 — Queirós, M. (1980b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XVII. Papaveraceae. Bol. Soc. Brot. 54: 153-171.
n 118×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 15-17. Garca, I.Lagascalia7(2): 199-201(1977).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 464-470. Gallego Cidoncha, M. J.Lagascalia14(2): 286-288(1986).
CCDB · ipcn-api-dl — Gallego Cidoncha, M. J. 1986. Números cromosómicos para la flora Española, 464--470. Lagascalia 14: 286–288.
CCDB · ipcn-api-dl — Garcia, I. 1978. In Numeros cromosomicos para la flora Esparhola. 1-44. Lagascalia 7: 191–216.
CCDB · book-ipcn75-78 — Garcia 1978
CCDB · CromoCat 2015 — Gallego, M. J. (1986). Números cromosómicos para la flora española, 464-470. Lagascalia 14(2): 286-288.
CCDB · CromoCat 2015 — García, I. (1977). Números cromosómicos para la flora española, 15-17. Lagascalia 7(2): 199-201.
CCDB · CromoCat 2015 — García, I. (1978). In Numeros cromosomicos para la flora Esparhola. 1-44. Lagascalia 7: 191-216.
n 145×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · book-ipcn72 — KOUL, A.K., R.N. GOHIL, M.C. SHARMA, & H.K. KAPOOR. 1972. Genetic stocks of Kashmir Papavers, I. Plant morphology, chromosome numbers and meiosis. Nucleus 15: 117-123.
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1300-1301
n 215×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn75-78 — Bismark & Bassler 1974
CCDB · CromoCat 2015 — Bismark, S. & Bässle, M. (1974). Beiträge zur cytologie einiger sippen aus der flora der DDR. Gleditschia 2: 17-28.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
n 281×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — KOOPMANS, A. 1970. Preliminary notes on crosses between Papaver dubium L. (2n=42l and P. rhoeas L. (2n=14). Acta Bot. Neer!. 19: S33~
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type133 700 records
Wild obs. + sensor128 932
Museum / vouchered4 670
Cultivated / captive18
Fossil1
Other79
Origin
Native1 621
Introduced5 857
Range
Area of Occupancy AOO217 772 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy32% within 1 km
≤100 m 16 050≤1 km 20 711≤10 km 78 432>10 km 713
115 906 georeferenced · 13 026 without coordinates
Open the mapobservation + sensor128 932
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 226≤1 km 719≤10 km 1 213>10 km 173
2 331 georeferenced · 2 339 without coordinates
Open the institutions mapphysical evidence4 670
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 16
17 georeferenced · 1 without coordinates
Open the mapnot free-living18
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions126 of 208 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 764 |
| Paris, FR | 367 |
| BFLlocation not on record | 156 |
| BIO-UNIPIlocation not on record | 149 |
| Tartu, EE | 139 |
| Moscow State Universitylocation not on record | 90 |
| MeiseBGlocation not on record | 82 |
| LDlocation not on record | 82 |
| Helsinki, FI | 80 |
| Adam Mickiewicz University in Poznańlocation not on record | 80 |
| Oskarshamn, SE | 79 |
| Museo Entomologico de Leonlocation not on record | 78 |
| BClocation not on record | 76 |
| BDBClocation not on record | 75 |
| Berlin, DE | 69 |
| Görlitz, DE | 62 |
| Odawara, JP | 62 |
| Adelaide, AU | 56 |
| València, ES | 48 |
| GJOlocation not on record | 47 |
| Philadelphia, US | 45 |
| Entomological Society of Latvialocation not on record | 43 |
| Kochi, JP | 34 |
| Philadelphia, US | 34 |
| KMNlocation not on record | 34 |
| Tallinn, EE | 33 |
| SLU Artdatabankenlocation not on record | 32 |
| Canberra, AU | 31 |
| MAlocation not on record | 31 |
| Uppsala, SE | 31 |
| Barcelona, ES | 31 |
| South Kensington, GB | 29 |
| Hobart, AU | 26 |
| Nagano City, JP | 26 |
| BRNUlocation not on record | 25 |
| Olocation not on record | 23 |
| Badajoz, ES | 23 |
| CICYTEXlocation not on record | 22 |
| College of the Atlantic, Museumlocation not on record | 22 |
| University of Stellenboschlocation not on record | 22 |
| Turku, FI | 21 |
| Zürich, CH | 21 |
| Vitoria, ES | 21 |
| Auckland, NZ | 19 |
| Mount Annan, AU | 19 |
| Zürich, CH | 19 |
| College Park, US | 18 |
| Uniwersytet Warszawskilocation not on record | 17 |
| Chongqing Museumlocation not on record | 16 |
| Bando, JP | 15 |
| Chiba, JP | 15 |
| Tsukuba, JP | 15 |
| Salamanca, ES | 14 |
| Sanda, JP | 14 |
| TUR-Alocation not on record | 14 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 14 |
| Williamsburg, US | 14 |
| Provincia di Livornolocation not on record | 13 |
| Toyama, JP | 12 |
| Christchurch, NZ | 12 |
| Saint Louis, US | 11 |
| Wlocation not on record | 11 |
| Granada, ES | 11 |
| Sagamihara, JP | 11 |
| Oulu, FI | 10 |
| Wellington, NZ | 10 |
| Córdoba, ES | 10 |
| WTUlocation not on record | 10 |
| Uniwersytet Jagiellońskilocation not on record | 10 |
| Millersville, US | 9 |
| Tokushima, JP | 9 |
| Madrid, ES | 9 |
| Armidale, AU | 9 |
| Tampere, FI | 9 |
| Fulda, DE | 9 |
| Frankfurt am Main | 8 |
| Mlocation not on record | 8 |
| Tilburg, NL | 8 |
| Hiratsuka City Museumlocation not on record | 8 |
| Porrentruy, CH | 8 |
| Frauenfeld, CH | 7 |
| Emporia, US | 7 |
| Pullman, US | 7 |
| Fukushima Universitylocation not on record | 7 |
| Tomioka, JP | 7 |
| Wuzhou, CN | 7 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Alicante, ES | 6 |
| Pamplona, ES | 6 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 6 |
| J.F.Oberlin Universitylocation not on record | 6 |
| Nagatoro-machi, Chichibu-gun, JP | 5 |
| Trondheim, NO | 5 |
| PRClocation not on record | 5 |
| Bangkok, TH | 5 |
| PrivatHerblocation not on record | 5 |
| CJBGlocation not on record | 5 |
| Salzburg, AT | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| KURAlocation not on record | 5 |
| Vancouver, CA | 5 |
| Bronx, US | 4 |
| Tampa, US | 4 |
| Kew, GB | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| Fairfax, US | 4 |
| Sevilla, ES | 4 |
| Victoria, CA | 4 |
| Norfolk, US | 4 |
| Toyota city nature sanctuarylocation not on record | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| New Brunswick, US | 3 |
| UGentlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Glarus, CH | 3 |
| Corvallis, US | 3 |
| Baroda, IN | 3 |
| National Museum Waleslocation not on record | 3 |
| Sion, CH | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| EEZA-CSIClocation not on record | 3 |
| Fayetteville, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Chapel Hill, US | 3 |
| BSBIlocation not on record | 2 |
| Gijón, ES | 2 |
| Little Rock, US | 2 |
| Brussel, BE | 2 |
| Québec, CA | 2 |
| Allentown, US | 2 |
| Bloomington, US | 2 |
| Jaén, ES | 2 |
| Parkville, AU | 2 |
| Shinshu Universitylocation not on record | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Jyväskylä, FI | 2 |
| GZUlocation not on record | 2 |
| Pittsburg, US | 2 |
| San Angelo, US | 2 |
| Knoxville, US | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| GMBAlocation not on record | 2 |
| Moscow, US | 2 |
| Bourges, FR | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| ISAlocation not on record | 2 |
| Beijing, CN | 2 |
| Boise, US | 2 |
| Washington, US | 2 |
| Staten Island, US | 2 |
| Denver, US | 2 |
| Fort Worth, US | 2 |
| Porvoo, FI | 2 |
| Brisbane, AU | 2 |
| Saint John, CA | 1 |
| Monastir, TN | 1 |
| UIBlocation not on record | 1 |
| Edmonton, CA | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Winterthur, CH | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Namur, BE | 1 |
| Madison, US | 1 |
| Pamplona, ES | 1 |
| La Trobe Universitylocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Otaru, JP | 1 |
| H-AkrKGlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Caldwell, US | 1 |
| Albuquerque, US | 1 |
| MHNAIXlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Burlington, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Kuopio, FI | 1 |
| Tuscaloosa, US | 1 |
| Morgantown, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Dresden, DE | 1 |
| Xiamen, CN | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Göteborg, SE | 1 |
| JP | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Durham, US | 1 |
| UniKSlocation not on record | 1 |
| Nishihara, JP | 1 |
| Sendai, JP | 1 |
| Missoula, US | 1 |
| Springfield, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Provo, US | 1 |
| Dover, US | 1 |
| Hazara Universitylocation not on record | 1 |
| ESP003location not on record | 1 |
| New Haven, US | 1 |
208 institutions · 4 068 of 4 670 vouchered records shown · 453 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Papaver dubium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map6 countries0
on grassy road verge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.1 °C 7.50–17.1
Seasonal swing summer↔winter14.4 °C
Max temp (day)16.7 °C 9.60–20.5
Min temp (night)10.3 °C 3.50–13.9
Precipitation76.7 mm/mo 63.5–105
Air humidity62.8 % 57.9–66.3
Moisture balance-10.4 mm/mo
Vapour deficit585 Pa 400–804
Wind speed4.00 m/s
Cloud cover45.2 % 39.3–52.3
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.