Papaver commutatum

Fisch. & C.A.Mey. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Papaver

At a glance

Occurrence records115

Data sources9

Biological traits15

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Papaver commutatum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS71 compounds

Occurrence & distributionGBIF115 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT2.8 Gbp

01Narrative

Papaver commutatum, the Caucasian scarlet poppy, is a species of flowering plant in the family Papaveraceae native to northern Turkey, northwestern Iran and the Caucasus. It is an erect annual growing to 45 cm tall by 15 cm wide, with hairy stalks and leaves. The flower is bowl-shaped and about 8 cm in diameter, bright red with prominent black blotches at the bases of the petals, and is borne in early summer. The flowers are followed by spherical seed heads. The Latin specific epithet commutatum means “changed”, referring to a change of name from another species. The cultivar P. commutatum 'Ladybird' is a popular and easy garden annual for a sunny position in a moist, fertile spot. It bears many flowers on each plant and blooms from late spring to early summer. It is frequently a feature of cultivated wildflower meadows. It has gained the Royal Horticultural Society's Award of Garden Merit, as has the species. The main alkaloid of this species is isocorydine.Sariyar, G. (2002). Biodiversity in the alkaloids of Turkish Papaver species. Pure and Applied Chemistry 74(4), 557-74.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height0.326 m

Plant height max0.5 m

Seed mass0.128 mg

Life cycle & reproduction6

Dispersal typewind

Flowering endMay

Flowering startApr

Life formannual

Life spanannual

Raunkiær life formtherophyte

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTcrop fields, roadsides, semidesert

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)23.2 mm²/mg

03Chemical composition71 compounds

Compounds documented for Papaver commutatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids10

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids8

Ursane and Taraxastane triterpenoids5

Isoquinoline alkaloids5

Bauerane triterpenoids3

Documented compounds71 total

Tissue Source Quantified only

Compound	Amount	Source
(+-)-Sinactine	present	LOTUS
(-)-alpha-Narcotine	present	NPASS
(1R,14S,24S)-13-methyl-5,7,19,21,25-pentaoxa-13-azahexacyclo[12.11.0.02,10.04,8.015,23.018,22]pentacosa-2,4(8),9,15(23),16,18(22)-hexaen-24-ol	present	LOTUS
(1S,3R,6S,8S,11R,12R,15R,16R)-7,7,12,16-tetramethyl-15-[(2S)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(3R)-6,7-Dimethoxy-3-(4-Methoxy-6-Methyl-7,8-Dihydro-5H-[1,3]Dioxolo[4,5-G]Isoquinolin-5-Yl)-3H-2-Benzofuran-1-One	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(4R,12Bs)-7,9-Dimethoxy-3-Methyl-2,4,7A,13-Tetrahydro-1H-4,12-Methanobenzofuro[3,2-E]Isoquinoline	present	NPASS
(5bR,13bR,15S)-5b,6,7,8,13b,15-Hexahydro-15-methoxy-6-methyl-[1,3]dioxolo[4,5-h]-1,3-dioxolo[7,8][2]benzopyrano[3,4-a][3]benzazepine	present	LOTUS
(S)-Isocorydine	present	LOTUS
1,2-Dimethoxy-12-Methyl-[1,3]Benzodioxolo[5,6-C]Phenanthridin-12-Ium;Hydroxide	present	NPASS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Papaver commutatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ250313.1 ↗645 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGTGAACACGTGAACCCAAGTTCAGTGGTGATGCAAGTGGGGAGAGATCCCCCTTGCTCCACCGC …

Papaver commutatum voucher 2000.0605 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Papaver commutatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 836 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Papaver commutatum2.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

07Deep time~1.27 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.27 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type115 records

Wild obs. + sensor47

Museum / vouchered68

Range

Area of Occupancy AOO372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 14≤1 km 7≤10 km 4>10 km 9

34 georeferenced · 13 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 5≤10 km 17>10 km 1

23 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence68

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	33
Tsukuba, JP	5
Wlocation not on record	5
LDlocation not on record	4
Paris, FR	3
Odawara, JP	3
Frankfurt am Main	3
BRNUlocation not on record	2
Berlin, DE	2
Tomioka, JP	2
Oskarshamn, SE	1
Wellington, NZ	1
Görlitz, DE	1
Bando, JP	1
BClocation not on record	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1

16 institutions · 68 of 68 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)