Papaver armeniacum

(L.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Papaver

At a glance

Occurrence records35

Data sources12

Biological traits17

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Papaver armeniacum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS32 compounds

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · NCBI≈3 Gbp

01Narrative

Мак армянский — вид травянистых растений рода Мак (Papaver) семейства Маковые (Papaveraceae), распространённый на Кавказе и в Западной Азии.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.4 m

Plant height min0.15 m

Seed mass0.12 mg

Seed mass max0.12 mg

Seed mass min0.12 mg

Life cycle & reproduction6

Dispersal typewind

Flowering endAug

Flowering startJun

Life formbiennial

Life spanbiennial

Raunkiær life formtherophyte

Habitat & environment5

Climatetemperate

Elevation max3 000 m

Growth formherb

Habitat GIFTstony places

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition32 compounds

Compounds documented for Papaver armeniacum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids8

Isoquinoline alkaloids $ Morphinan alkaloids6

Isoquinoline alkaloids $ Protoberberine alkaloids6

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids6

Aporphine alkaloids $ Isoquinoline alkaloids4

Documented compounds32 total

Tissue Source Quantified only

Compound	Amount	Source
(+-)-Sinactine	present	LOTUS
(-)-Mecambridine	present	LOTUS
(-)-Reticuline	present	LOTUS
(12R)-11-methylspiro[3,5-dioxa-11-azatetracyclo[6.6.1.02,6.012,15]pentadeca-1(15),2(6),7-triene-14,4'-cyclohexa-2,5-diene]-1'-one	present	LOTUS
(13R)-16,17-dimethoxy-5,7-dioxa-1-azapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),9,14,16,18-hexaene	present	LOTUS
(13S)-16-methoxy-5,7-dioxa-1-azapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),9,14,16,18-hexaen-17-ol	present	LOTUS
(1R,11R,13S)-11,17-dimethoxy-6,8,12-trioxa-22-azapentacyclo[11.9.0.02,10.05,9.014,19]docosa-2(10),3,5(9),14,16,18-hexaen-16-ol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[[(6aR)-1-methoxy-6-methyl-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinolin-2-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
(5bR,12bS,14S)-5b,6,7,8,12b,14-Hexahydro-10,11,14-trimethoxy-1,3-dioxolo(7,8)(2)benzopyrano(3,4-a)(3)benzazepine	present	LOTUS
(5bR,12bS,14S)-5b,6,7,8,12b,14-Hexahydro-10,11,14-trimethoxy-6-methyl-1,3-dioxolo[7,8][2]benzopyrano[3,4-a][3]benzazepine	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Papaver armeniacum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences6

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSDQ250297.1 ↗645 bp

ACGT

TCGAAACCTGCCTAGCAGAACGACCCGCGAACACGTGAATCCAAGTTCAGTGGTGATGCAAGTGGGGAGAGATCCCCCTTGCTCCACCGC …

Papaver armeniacum voucher 2000.0604 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Papaver armeniacum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 980 240 000 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Papaver armeniacum2.98 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 144×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Chariat-Panahi, M. S., H. Lessani & D. Cartier. 1982. Etude caryologique de quelques espèces de la flore de l'Iran. Rev. Cytol. Biol. Veg. Bot. 5: 189–197.

CCDB · ipcn-api-dl — Lessani, H. & S. Chariat-panahi. 1979. In IOPB chromosome number reports LXV. Taxon 28: 635–636.

CCDB · ipcn-api-dl — Özhatay, N. 1982. Türkiye'nin çok yillik Papaver türlerinin kromozomlari. Türkiye'nin Papaver türleri üzerinde aras|7tirmalar (Prof. Sarim Çelebioğlu'nun Dr. Phil. ünvanini alis|7inin 50. yildönümü nedeniyle Istanbul Üniversitesi Eczacilik Fakültesinde yapilan bilimsel toplanti) 22--27.

CCDB · book-fedorov — Sugiura 1938

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type35 records

Wild obs. + sensor20

Museum / vouchered14

Other1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 8≤1 km 1≤10 km 4>10 km 3

16 georeferenced · 4 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bratislava, SK	6
Paris, FR	5
Wlocation not on record	2

3 institutions · 13 of 14 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Papaver armeniacum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)