Papaver aculeatum

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Papaver

At a glance

Occurrence records520

Data sources9

Biological traits28

DNA specimens6

eDNA detections4

Sources9 archives

Databases and archives Papaver aculeatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility520 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF520 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Papaver aculeatum est une espèce de plantes à fleurs dicotylédones de la famille des Papaveraceae, sous-famille des Papaveroideae. C'est une plante herbacée originaire d'Afrique australe. C'est une plante annuelle ou vivace à courte durée de vie, aux fleurs orange ou rouges, pouvant atteindre 40 à 60 cm voire 1,5 mètre de haut. C'est la seule espèce du genre Papaver endémique de l'hémisphère Sud. - Étymologie - l'épithète spécifique, aculeatum, est un adjectif latin qui signifie « piquant, portant des aiguillons », en référence aux feuilles et tiges épineuses.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length25 mm

Fruit width7 mm

Leaf length150 mm

Leaf length max150 mm

Leaf width max4 mm

Leaf width min2 mm

Plant height1 m

Plant height max1 m

Plant height min0.1 m

Life cycle & reproduction6

Dehiscencedehiscent

Dispersal typewind

Life formannual

Life spanannual

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max3 050 m

Elevation min500 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobovate ovate

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Papaver aculeatum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences2

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ250316.1 ↗644 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCTGTGAACACGTGAATCCAAGTTCAGTGGTAATGCAAGTGGGGAGAAATCTCCCTTGGCTCTACCC …

Papaver aculeatum voucher 2000.0659 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Papaver aculeatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Kadereit, J. W. 1988. The affinities of the south-hemispherical Papaver aculeatum Thunb. (Papaveraceae). Bot. Jahrb. Syst. 109: 335–341.

CCDB · book-ipcn67-71 — RECKIN, J. 1970. A contribution to the cytology of Papaver aculeatum Thunb. Caryologia 23: 461-464.

CCDB · book-ipcn73-74 — RECKIN, J. 1973. A contribution to the cytology of Papaver gracile Auch. including proposals for a revision of the Section Mecones. caryologia 26: 245-251.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type520 records

Wild obs. + sensor105

Museum / vouchered410

Cultivated / captive1

Other4

Origin

Introduced179

Range

Area of Occupancy AOO1 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 38≤1 km 19≤10 km 36>10 km 5

98 georeferenced · 7 without coordinates

Open the mapobservation + sensor105

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 36≤1 km 39≤10 km 120>10 km 39

234 georeferenced · 176 without coordinates

Open the institutions mapphysical evidence410

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	117
Museo Entomologico de Leonlocation not on record	64
Mount Annan, AU	53
Adelaide, AU	47
Brisbane, AU	26
Canberra, AU	22
Durban, ZA	14
Paris, FR	13
Hobart, AU	6
Saint Louis, US	4
Armidale, AU	3
Parkville, AU	3
Edinburgh, GB	2
Cape Town, ZA	2
Zürich, CH	2
MAlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
MSB-3054location not on record	1
Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record	1
Christchurch, NZ	1
MeiseBGlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
La Trobe Universitylocation not on record	1
South African National Biodiversity Institute, Compton Herbariumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

25 institutions · 388 of 410 vouchered records shown · 22 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Papaver aculeatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 17.8–20.9

Seasonal swing summer↔winter11.3 °C

Max temp (day)25.6 °C 24.0–27.2

Min temp (night)13.1 °C 11.9–14.3

Precipitation47.7 mm/mo 23.8–71.5

Air humidity54.3 % 52.1–56.5

Moisture balance-110 mm/mo -122–-98.0

Vapour deficit1,041 Pa 894–1,188

Wind speed3.80 m/s 3.60–4.00

Cloud cover21.3 % 14.0–28.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)