Panopoda carneicosta

Guenée, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Panopoda

At a glance

Occurrence records4 581

Data sources7

Biological traits0

DNA specimens57

eDNA detections57

Sources7 archives

Databases and archives Panopoda carneicosta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 581 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 581 records

Environmental DNA1 datasets · 2 countries57 detections

DNA & barcodingBOLD57 specimens

01Narrative

Panopoda carneicosta, the brown panopoda, is a moth of the family Erebidae. The species was first described by Achille Guenée in 1852. It is found in North America from Ontario, Quebec and Maine, south to Florida, west to Texas, north to Wisconsin and Minnesota. The wingspan is 38–46 mm. Reported flight periods vary. Charles V. Covell Jr. gives a flight period of May to August, and Ohio State University gives a flight period of April to September. They are most seen in June and July though. There is one generation per year in the north, possibly two in the south. The larvae feed on the leaves of basswood, oak, hickory and willow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panopoda carneicosta has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes1

eDNA detections57

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus56 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

58Gvariable

187Cvariable

259Cmostly conserved

313Cmostly conserved

337Tvariable

364Cmostly conserved

TACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTGTTAATTCGTGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.46%

Haplotypes18

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Panopoda repandasame genus2.9%Panopoda rufimargosame genus3.0%Panopoda rigidasame genus4.9%Ercheia dubiasame family7.3%Bryophila maeonissame order7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 581 records

Wild obs. + sensor4 109

Museum / vouchered472

Range

Area of Occupancy AOO7 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 2 049≤1 km 681≤10 km 192>10 km 320

3 242 georeferenced · 867 without coordinates

Open the mapobservation + sensor4 109

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 12≤1 km 57≤10 km 204>10 km 31

304 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence472

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	108
East Lansing, US	74
CUlocation not on record	35
Mississippi State, US	30
Cambridge, US	27
Georgia Museum of Natural Historylocation not on record	25
Cleveland Museum of Natural History, OH (CLEV)location not on record	24
King Saud Universitylocation not on record	23
Colorado State Universitylocation not on record	18
ASUlocation not on record	10
St. Paul, US	8
Toronto, CA	6
UDlocation not on record	5
Denver, US	4
Cornell University Insect Collectionlocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
University of Alberta Museums (UAM)location not on record	4
University of Alabamalocation not on record	3
Philadelphia, US	1
University of California, Davislocation not on record	1
Vernal, US	1
OSUClocation not on record	1
Chicago, US	1
Natural History Museum of Utahlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
SOVTlocation not on record	1
Champaign, US	1

27 institutions · 421 of 472 vouchered records shown · 51 without an institution code

09Environmental DNA57 detections

Where the DNA of Panopoda carneicosta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found57

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 57 detections have coordinates

Open the map2 countries0

Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 17.9–27.4

Seasonal swing summer↔winter21.9 °C

Max temp (day)28.8 °C 22.7–33.0

Min temp (night)18.7 °C 13.5–23.2

Precipitation125 mm/mo 79.6–238

Air humidity59.5 % 55.2–61.6

Moisture balance-32.4 mm/mo -90.5–73.2

Vapour deficit1,217 Pa 886–1,510

Wind speed2.50 m/s 2.00–5.60

Cloud cover32.8 % 28.1–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 57 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Panopoda carneicosta

At a glance

Sources7 archives

At a glance

Record type4 581 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 581 records