Panicum simile

Domin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Panicum

At a glance

Occurrence records10 064

Data sources7

Biological traits37

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Panicum simile's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 064 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF10 064 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Panicum simile, known by the common name two colour panic, is a species of grass found in eastern Australia.Les Robinson - Field Guide to the Native Plants of Sydney, page 273 It was described by Karel Domin in 1915.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Leaf length150 mm

Leaf length max0.75 mm

Leaf length min0.25 mm

Leaf mass7.4 mg

Leaf mass per area57.54 g/m2

Leaf size122 mm²

Leaf width3 mm

Leaf width max3.5 mm

Leaf width min1 mm

Plant height0.55 m

Plant height max0.7 m

Seed mass0.911 mg

Seed mass max0.91 mg

Seed mass min0.91 mg

Life cycle & reproduction10

Dispersal typewind

Flowering timeyynnnnnnnnny

Life formperennial

Life spanperennial

Lifespan years25 years

Pollination syndromeabiotic

Raunkiær life formhemicryptophyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: tussock

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panicum simile has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594317.1 ↗619 bpAustralia · 2018

ACGT

AACGACATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAGGATTATAAATTGACTTACTACACCCCGGAG …

Panicum simile voucher 600400500 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type10 064 records

Wild obs. + sensor8 536

Museum / vouchered797

Cultivated / captive1

Other730

Origin

Native131

Introduced1

Range

Area of Occupancy AOO19 952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 7 747≤1 km 607≤10 km 119>10 km 14

8 487 georeferenced · 49 without coordinates

Open the mapobservation + sensor8 536

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 223≤1 km 65≤10 km 322>10 km 143

753 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence797

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	278
Mount Annan, AU	131
Canberra, AU	118
NSW Dept of Planning, Industry and Environmentlocation not on record	88
Museo Entomologico de Leonlocation not on record	57
NSW Office of Environment and Heritagelocation not on record	42
Armidale, AU	15
Smithfield, AU	14
Adelaide, AU	9
John T. Waterhouse Herbariumlocation not on record	8
Batemans Bay, AU	8
Wollongong, AU	6
Kew, GB	5
James Cook Townsvillelocation not on record	4
Palmerston, AU	3
Hobart, AU	2
Auckland, NZ	2
Berlin, DE	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
University of the Sunshine Coastlocation not on record	1

21 institutions · 794 of 797 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Panicum simile was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 22.4–22.4

Seasonal swing summer↔winter10.1 °C

Max temp (day)26.7 °C

Min temp (night)18.5 °C

Precipitation111 mm/mo

Air humidity59.7 %

Moisture balance-40.3 mm/mo

Vapour deficit1,088 Pa

Wind speed2.00 m/s

Cloud cover20.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Panicum simile

At a glance

Sources7 archives

Size & morphology14

Life cycle & reproduction10

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Record type10 064 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 064 records