Panicum queenslandicum

Domin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Panicum

At a glance

Occurrence records2 079

Data sources7

Biological traits25

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Panicum queenslandicum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 079 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF2 079 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Panicum queenslandicum is a species of monocotyledon described by Karel Domin. Panicum queenslandicum belongs to the genus Panicum, and the family Poaceae. No subspecies are listed. The species is native to the Maluku Islands, New Guinea and the Australian states of New South Wales, Queensland and Victoria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Leaf length225 mm

Leaf width2.5 mm

Plant height0.8 m

Plant height max0.8 m

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennyyyyynnnnn

Life formperennial

Life spanperennial

Pollination syndromeabiotic

Raunkiær life formhemicryptophyte

Resprouting capacityfire_killed

Sex typeandromonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

⚠ sources differ — AusTraits: caryopsis · GIFT: nut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: tussock

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panicum queenslandicum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences8

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMZ015213.1 ↗635 bp

ACGT

CCTGCGGAAGGATCATTGTCGTGACCCTTAAACAAAATAGACTGTGAACATGTCATCCATGTCGTCGGGCTACGTTCCGGCTAAGGCCCC …

Panicum queenslandicum voucher 73410 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type2 079 records

Wild obs. + sensor1 378

Museum / vouchered384

Cultivated / captive1

Other316

Origin

Native72

Range

Area of Occupancy AOO5 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 315≤1 km 22≤10 km 26

1 363 georeferenced · 15 without coordinates

Open the mapobservation + sensor1 378

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 164≤1 km 24≤10 km 111>10 km 63

362 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence384

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	121
NSW Dept of Planning, Industry and Environmentlocation not on record	91
Mount Annan, AU	74
Canberra, AU	50
NSW Office of Environment and Heritagelocation not on record	19
Museo Entomologico de Leonlocation not on record	12
Armidale, AU	5
Kew, GB	3
Adelaide, AU	3
John T. Waterhouse Herbariumlocation not on record	2
Hobart, AU	1
Museo Nacional de Costa Rica (MNCR)location not on record	1
Smithfield, AU	1

13 institutions · 383 of 384 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Panicum queenslandicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Panicum queenslandicum

At a glance

Sources7 archives

Size & morphology4

Life cycle & reproduction9

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Other traits1

At a glance

Record type2 079 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 079 records