Panicum miliaceum
speciesAt a glance
Occurrence records27 371
Data sources15
Biological traits135
DNA specimens38
eDNA detections22
Sources15 archives
Databases and archives Panicum miliaceum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility27 371 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources135 traits
Chemical compositionFooDB · LOTUS · NPASS5 792 compounds
Occurrence & distributionGBIF27 371 records
Environmental DNA1 datasets · 8 countries22 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB · GoaT · NCBI1 Gbp
01Narrative
Panicum miliaceum, le millet commun ou millet, est une espèce de plantes monocotylédones de la famille des Poaceae, sous-famille des Panicoideae, originaire de l'Asie tempérée. Cette plante annuelle herbacée, cultivée pour ses graines comestibles, est une céréale secondaire, bien adaptée aux zones semi-arides, qui constitue encore une culture vivrière dans certaines régions d'Asie. C'est aussi une mauvaise herbe des cultures, classée comme telle dans certains États des États-Unis. - Noms vernaculaires - mil, mil d'Inde, millet, millet blanc, millet commun, millet cultivé, millet des oiseaux, panic, panic faux millet, panic faux-millet, panic millet, kibi.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology25
Inflorescence length max30 cm
Inflorescence length min10 cm
Leaf length300 mm
Leaf length max300 mm
Leaf length min1 mm
Leaf size1 560 mm²
Leaf width5 mm
⚠ sources differ — AusTraits: 5 mm · GIFT: 13 mm
Leaf width max25 mm
Leaf width min4 mm
Plant height0.69 m
⚠ sources differ — GIFT: 0.69 m · AusTraits: 1.1 m · LEDA: 0.6 m · USDA: 0.914 m · TRY: 0.886 m
Plant height generative0.65 m
Plant height max1.2 m
Plant height min0.2 m
Seed length2.74 mm
⚠ sources differ — TRY: 2.74 mm · GIFT: 1.7 mm
Seed length max1.7 mm
Seed length min1.7 mm
Seed mass4.5 mg
⚠ sources differ — TRY: 4.5 mg · AusTraits: 4.3 mg · LEDA: 3.78 mg · GIFT: 4.47 mg
Seed mass max5.41 mg
Seed mass min3.73 mg
Seed volume4.1 mm³
Seed volume max4.1 mm³
Seed volume min4.1 mm³
Seed width1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction34
Bloom periodSummer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: ethelochor · GIFT: anemochorous
Flower colourwhite
Flower conspicuousNo
Flowering endSep
Flowering startJun
Flowering timeyynnnnnnnnny
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSummer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max3 300 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Growth form USDABunch
Habitat GIFTÁrea Antrópica, Campo Limpo
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min10 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry21
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min120 days
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Precipitation max50 in
Precipitation min25 in
Protein potentialMedium
Salinity toleranceNone
Shade toleranceHigh
Soil pH max6.8 pH
Soil pH min5.8 pH
Temperature min47 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound84 800 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typefruit with appendage
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
Inflorescencepanicle
Shoot orientationerect
03Chemical composition5 792 compounds
Compounds documented for Panicum miliaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingCereals and cereal products
Compound class profile5 classes
Aminoacids161
Glycerophospholipids57
Pyridine alkaloids36
Cinnamic acids and derivatives34
pteridine alkaloids30
Documented compounds5 792 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| α-D-galactose | 69,880 mg/100g | FooDB | |
| L-Glutamic acid | 2,599 mg/100g | FooDB | |
| (Z,Z)-9,12-Octadecadienoic acid | 2,549 mg/100g | FooDB | |
| (E)-2-Phenyl-2-butenal | 2,500 mg/100 g | FooDB | |
| Nitrogen | 2,100 mg/100 g | FooDB | |
| Sugars | 1,660 mg/100g | FooDB | |
| L-Leucine | 1,600 mg/100g | FooDB |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panicum miliaceum has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes8
GenBank sequences10
eDNA detections22
Countries8
The DNA barcodea real sequence read deposited for this species
AGGAACACTGATATTGCCTTGCTCGGGGTCATGCTCGGCCTGCCGCGCTTGCCCCGTGCAATGTTGCTATCTTAATCCACACGACTCTCG …
Panicum miliaceum voucher KS23 HER0249 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★rbcLa★ITS6★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Panicum miliaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 017 120 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Panicum miliaceum1.02 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records18–362n range36median36mode46records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3643×CCDB · slov-fl · CCDB · iapt · CCDB · nw-europe-fl +7
CCDB · slov-fl — Králik E. & Kothajová H., 2000: Karyologické štúdium slovenskej flóry XXXIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 37-41.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Murín A., Svobodová Z., Májovský J. & Feráková V., 1999: Chromosome numbers of some species of the Slovak flora. - Thaiszia - J. Bot., Košice 9/1: 31-40.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4687
CCDB · poland — Frey L., Mizianty M. and Mirek Z. 1981. Chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 581-590.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1983. Chromosome numbers in Adoxaceae, Chloranthaceae, Cupressaceae, Juncaceae, Poaceae. Bot. Zhurn. SSSR 68 (12): 1683.
CCDB · ipcn-api-dl — Frey, L., M. Mizianty & Z. Mirek. 1981. Chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 581–590.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
CCDB · ipcn-api-dl — Hamoud, M. A., S. A. Haroun, R. D. Macleod & A. J. Richards. 1994. Cytological relationships of selected species of Panicum L. Biol. Pl. 36: 37–45.
CCDB · ipcn-api-dl — Haroun, S. A. 1995. Cytological abnormality control seed set in Panicum repens L. in Egypt. Cytologia 60: 347–351.
CCDB · ipcn-api-dl — Warwick, S. I., C. Crompton, L. D. Black & W. Wotjas. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 25–26.
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
CCDB · ipcn-api-dl — Strid, A. 1980. In Chromosome number reports LXIX. Taxon 29: 709–710.
CCDB · ipcn-api-dl — Murín, A., Z. Svobodová, J. Májovský & V. Feráková. 1999. Chromosome numbers of some species of the Slovak flora. Thaiszia 9(1): 31–40.
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-fedorov — AliAfJIOB 1931
CCDB · book-fedorov — Rau N. 1929a
CCDB · book-fedorov — Chandola 1959
CCDB · book-atlas-flowering-plants
CCDB · Cave1959 — Ohandola. 1959
CCDB · CromoCat 2015 — Arenkova, D. N. (1940). Polyploid races in millet (Panicum miliaceum L.). Dokl. Akad. Nauk. SSSR. 29: 332-334.
CCDB · CromoCat 2015 — Avdulov, N. P. (1931). Karyo-systematische Untersuchungen der Familie Gramineen. Bull. Appl. Bot., Genet. & Plant Breeding Suppl. 43: 1-438.
CCDB · CromoCat 2015 — Chandola, R. P. (1959). Cytogenetics of millets (1). Cytologia 24: 115-137.
CCDB · CromoCat 2015 — Frey, L., Mizianty, M. & Mirek, Z. (1981). Chromosome numbers of polish vascular plants. Fragm. Florist. Geobot. 27: 581-590.
CCDB · CromoCat 2015 — Hamoud, M. A., Haroun, S. A., Macleod, R. D. & Richards, A. J. (1994). Cytological relationships of selected species of Panicum L. Biologia Plantarum 36: 37-45
CCDB · CromoCat 2015 — Haroun, S. A. (1995). Cytological abnormality control seed set in Panicum repens L. in Egypt Cytologia 60: 347-351
CCDB · CromoCat 2015 — Parfitt, B. D. (1981). ln Chromosome number reports LXXI. Taxon 30: 515-516.
CCDB · CromoCat 2015 — Probatova, N. S. & A. P. Sokolovskaya. (1983). New chromosome numbers for vascular plants from the Islands of Peter the Great Bay (Primorye Territory). J. Bot. URSS 68(12): 1655-1662.
CCDB · CromoCat 2015 — Singh, D. N. & M. B. E. Godward. (1960). Cytological studies in the Gramineae. Heredity 15(2-3): 193-199
CCDB · CromoCat 2015 — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh (1990). SOCGI plant chromosome number reports---IX J. Cytol. Genet. 25: 140-143
CCDB · CromoCat 2015 — Strid, A. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 709-710.
CCDB · CromoCat 2015 — Warwick, S. I., C. Crompton, L. D. Black & W. Wotjas. (1997). IOPB Chromosome Data 11 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 26-27: 25-26.
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
CCDB · iapt — IAPT/IOPB Chromosome Data 22
CCDB · iapt — IAPT/IOPB Chromosome Data 23
CCDB · iapt — IAPT/IOPB Chromosome Data 27
CCDB · iapt — IAPT/IOPB Chromosome Data 30
2n 183×CCDB · slov-fl · CCDB · iapt · CCDB · ipcn-api-dl
CCDB · slov-fl — Murín A., 1992: Karyological study of the Slovak flora XXIV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 45-51.
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · ipcn-api-dl — Murín, A. 1992. Karyological study of the Slovak flora XXIV. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 39: 45–51.
2n 491×CCDB · book-fedorov
CCDB · book-fedorov — Fairbrothers 1954
n 185×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ahsan, S. M. N., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers and incidence of polyploidy in Panicoideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 775–783.
CCDB · ipcn-api-dl — Strid, A. 1980. In Chromosome number reports LXIX. Taxon 29: 709–710.
CCDB · CromoCat 2015 — Ahsan, S. M. N., Vahidy, A. A. & Ali, S. I. (1994). Chromosome numbers and incidence of polyploidy in Panicoideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 775-783
CCDB · CromoCat 2015 — Parfitt, B. D. & N. A. Harriman. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 515-516.
CCDB · CromoCat 2015 — Strid, A. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 709-710.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
Completeness99.1% BUSCO
08Occurrence & distribution
Record type27 371 records
Wild obs. + sensor22 842
Museum / vouchered3 987
Cultivated / captive100
Other442
Origin
Native29
Introduced1 788
Range
Area of Occupancy AOO61 604 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy55% within 1 km
≤100 m 8 675≤1 km 2 053≤10 km 8 694>10 km 228
19 650 georeferenced · 3 192 without coordinates
Open the mapobservation + sensor22 842
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 536≤1 km 493≤10 km 649>10 km 297
1 975 georeferenced · 2 012 without coordinates
Open the institutions mapphysical evidence3 987
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 21>10 km 21
42 georeferenced · 58 without coordinates
Open the mapnot free-living100
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions192 of 326 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Québec, CA | 210 |
| LDlocation not on record | 188 |
| Helsinki, FI | 180 |
| Olocation not on record | 173 |
| DBF-NHMDlocation not on record | 149 |
| Moscow State Universitylocation not on record | 136 |
| SLU Artdatabankenlocation not on record | 126 |
| POL003location not on record | 100 |
| Uppsala, SE | 63 |
| MeiseBGlocation not on record | 61 |
| Oskarshamn, SE | 61 |
| Irkutsk State Universitylocation not on record | 52 |
| Beijing, CN | 46 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 46 |
| Oulu, FI | 45 |
| BDBClocation not on record | 39 |
| Philadelphia, US | 38 |
| Tartu, EE | 37 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 37 |
| Tempe, US | 36 |
| Görlitz, DE | 35 |
| Mount Annan, AU | 35 |
| Adelaide, AU | 35 |
| Turku, FI | 34 |
| BFLlocation not on record | 33 |
| Adam Mickiewicz University in Poznańlocation not on record | 28 |
| Philadelphia, US | 28 |
| IDElocation not on record | 27 |
| South Kensington, GB | 27 |
| KMNlocation not on record | 26 |
| New Haven, US | 26 |
| Chongqing Museumlocation not on record | 25 |
| Bern, CH | 24 |
| Trondheim, NO | 23 |
| Allentown, US | 23 |
| BClocation not on record | 23 |
| Museo Entomologico de Leonlocation not on record | 23 |
| Denver, US | 22 |
| Brisbane, AU | 22 |
| Salzburg, AT | 22 |
| Xinxiang, CN | 21 |
| Canberra, AU | 21 |
| BRNUlocation not on record | 20 |
| San Isidro, AR | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Ann Arbor, US | 18 |
| Uniwersytet Wrocławskilocation not on record | 18 |
| Auckland, NZ | 18 |
| Riverside, US | 17 |
| Chengdu, CN | 17 |
| Yangling, CN | 17 |
| Mlocation not on record | 16 |
| Spearfish, US | 16 |
| International Salmonella Centre (W.H.O.)location not on record | 16 |
| Tampa, US | 15 |
| University of New Hampshirelocation not on record | 15 |
| Kunming, CN | 15 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 15 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| Nijmegen, NL | 15 |
| Guangzhou, CN | 14 |
| Santa Barbara, US | 14 |
| Hobart, AU | 14 |
| Christchurch, NZ | 14 |
| ASUlocation not on record | 14 |
| Flagstaff, US | 13 |
| PRClocation not on record | 13 |
| Stockholm, SE | 13 |
| Bergen, NO | 13 |
| Université Lavallocation not on record | 13 |
| Davis, US | 12 |
| Provincia di Livornolocation not on record | 12 |
| Victoria, CA | 12 |
| Zhengzhou, CN | 12 |
| València, ES | 11 |
| Staten Island, US | 11 |
| Sanda, JP | 11 |
| Pullman, US | 10 |
| Logan, US | 10 |
| Barcelona, ES | 10 |
| Dresden, DE | 10 |
| TUR-Alocation not on record | 10 |
| Green Bay, US | 10 |
| Saint Louis, US | 9 |
| Frauenfeld, CH | 9 |
| GMBAlocation not on record | 9 |
| Claremont, US | 9 |
| Ciudad Autónoma de Buenos Aires, AR | 9 |
| Odawara, JP | 9 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 9 |
| Central China Normal Universitylocation not on record | 8 |
| University of Stellenboschlocation not on record | 8 |
| Madison, US | 8 |
| Kensington, AU | 8 |
| Jiangxi College of Educationlocation not on record | 8 |
| Wuhan, CN | 8 |
| Muzaffarabad, PK | 8 |
| Zapopan, MX | 8 |
| Pretoria, ZA | 8 |
| Porvoo, FI | 7 |
| Córdoba, AR | 7 |
| Uniwersytet Jagiellońskilocation not on record | 7 |
| Lanzhou, CN | 7 |
| Bozeman, US | 7 |
| Inner Mongolia Universitylocation not on record | 7 |
| Vancouver, CA | 7 |
| Acadia Universitylocation not on record | 7 |
| Wlocation not on record | 7 |
| Bronx, US | 6 |
| Nanjing, CN | 6 |
| Zürich, CH | 6 |
| Albuquerque, US | 6 |
| Corvallis, US | 6 |
| University of Winnipeglocation not on record | 5 |
| Tilburg, NL | 5 |
| Toronto, CA | 5 |
| Missoula, US | 5 |
| SZUlocation not on record | 5 |
| Frankfurt am Main | 5 |
| Tokushima, JP | 5 |
| Urumqi, CN | 5 |
| Taipei, TW | 5 |
| Guasave, MX | 4 |
| Durango, US | 4 |
| Austin, US | 4 |
| Phoenix, US | 4 |
| Bloomington, US | 4 |
| Universidad de Caldas (UCaldas)location not on record | 4 |
| San Diego, US | 4 |
| MAlocation not on record | 4 |
| ENTClocation not on record | 4 |
| Paris, FR | 4 |
| Berlin, DE | 4 |
| Tallinn, EE | 4 |
| Moscow, US | 4 |
| Awka, NG | 4 |
| Bend, US | 4 |
| EL PASO, US | 4 |
| WTUlocation not on record | 4 |
| Alicante, ES | 4 |
| Xining, CN | 4 |
| Wuhan, CN | 4 |
| Chengdu, CN | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Palmerston, AU | 4 |
| Servico de Microbiologia e Imunologialocation not on record | 4 |
| Knoxville, US | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 4 |
| Sagamihara, JP | 4 |
| Fulda, DE | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| Mexico City, MX | 3 |
| Durango, MX | 3 |
| Orem, US | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| Salvador, BR | 3 |
| Castelar, AR | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Pondicherry, IN | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| nlocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Glarus, CH | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| University of Hamburglocation not on record | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| CJBGlocation not on record | 3 |
| Miami, US | 3 |
| UChlocation not on record | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Peking Universitylocation not on record | 3 |
| Durban, ZA | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Shinshu Universitylocation not on record | 3 |
| Grand Junction, US | 3 |
| Zürich, CH | 3 |
| BSBIlocation not on record | 3 |
| Tsukuba, JP | 3 |
| Portland, US | 3 |
| ESP004location not on record | 3 |
| Mississippi State, US | 3 |
| Kawasaki Shi Tama Ku, JP | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Brasília, BR | 3 |
| Seoul, KR | 2 |
| Shanghai, CN | 2 |
| Karlsruhe, DE | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Jyväskylä, FI | 2 |
| Boise, US | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| UFBAlocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| GJOlocation not on record | 2 |
| Armidale, AU | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Burlington, US | 2 |
| Keene State Universitylocation not on record | 2 |
| Clemson, US | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Brussel, BE | 2 |
| Provo, US | 2 |
| Guangzhou, CN | 2 |
| Saint John, CA | 2 |
| QVMAGlocation not on record | 2 |
| Mazatlán, MX | 2 |
| Dekalb, US | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Xiamen, CN | 2 |
| Henderson, US | 2 |
| Montecillo, Texcoco, MX | 2 |
| NMBU:MINAlocation not on record | 2 |
| Lausanne, CH | 2 |
| KR | 2 |
| USFSlocation not on record | 2 |
| Guilin, CN | 2 |
| Kew, GB | 2 |
| San Luis Obispo, US | 2 |
| Fundación Miguel Lillolocation not on record | 2 |
| Millersville, US | 2 |
| Blumenau, BR | 2 |
| Corrientes, AR | 2 |
| JP | 2 |
| Sevilla, ES | 2 |
| Winterthur, CH | 2 |
| Lincoln, US | 2 |
| James Cook Townsvillelocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Whitewater, US | 1 |
| Yaoundé, CM | 1 |
| H-Dunkellocation not on record | 1 |
| San Angelo, US | 1 |
| Tacoma, US | 1 |
| Chiba, JP | 1 |
| CASlocation not on record | 1 |
| NMWlocation not on record | 1 |
| Salamanca, ES | 1 |
| Ivano-Frankove, UA | 1 |
| Chapingo, MX | 1 |
| Columbia, US | 1 |
| Torreón, MX | 1 |
| H-Zimmerlocation not on record | 1 |
| Wellington, NZ | 1 |
| WNNUlocation not on record | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Santa Cruz, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Kochi, JP | 1 |
| Beijing, CN | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Kyoto Universitylocation not on record | 1 |
| Chicago, US | 1 |
| Pocatello, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| US | 1 |
| JBRJlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Bothell, US | 1 |
| Banyoles, ES | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Nagano City, JP | 1 |
| Namur, BE | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Xian, CN | 1 |
| CZE122location not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Honolulu, US | 1 |
| Cenargenlocation not on record | 1 |
| State Herbarium of South Australialocation not on record | 1 |
| Tomioka, JP | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| St. Paul, US | 1 |
| DULlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Firenze, IT | 1 |
| Whitehorse, CA | 1 |
| Rotorua, NZ | 1 |
| Granada, ES | 1 |
| WINlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Nishihara, JP | 1 |
| Coimbra, PT | 1 |
| Forssa, FI | 1 |
| Philadelphia, US | 1 |
| Porrentruy, CH | 1 |
| Otaru, JP | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Elikins, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| GZUlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Urumqi, CN | 1 |
| Bourges, FR | 1 |
| Mexico City, MX | 1 |
| BISHlocation not on record | 1 |
| Bangkok, TH | 1 |
| TAIElocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Brookings, US | 1 |
| München, DE | 1 |
| IFR-DNFlocation not on record | 1 |
| nbflocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| UFSClocation not on record | 1 |
| Montréal, CA | 1 |
| H-Adlerlocation not on record | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Ashland, US | 1 |
| Fort Worth, US | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
326 institutions · 3 661 of 3 987 vouchered records shown · 305 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Panicum miliaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map8 countries0
Oak Woodland and pasture with Quercus agrifo…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.5 °C 11.4–24.0
Seasonal swing summer↔winter15.2 °C
Max temp (day)20.3 °C 13.8–30.1
Min temp (night)14.4 °C 9.30–18.0
Precipitation84.2 mm/mo 31.1–124
Air humidity61.1 % 52.8–63.1
Moisture balance-18.5 mm/mo -98.0–28.3
Vapour deficit756 Pa 487–1,411
Wind speed3.10 m/s 1.70–6.60
Cloud cover39.9 % 14.7–48.2
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.