Panicum lycopodioides

Bory ex Nees · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Panicum

At a glance

Occurrence records26

Data sources5

Biological traits7

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Panicum lycopodioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility26 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF26 records

DNA & barcodingNCBIsequences

01Narrative

Panicum lycopodioides, common name false club-moss panic grass or (in French) panic faux-lycopode, is endemic to the French island of Réunion in the Indian Ocean. It is found at high altitudes on the island, at elevations over 2000 m (6700 feet). The highest point on the island is Piton des Neiges, 3069 m (10,230 feet). The plant requires full sun-light and a cold climate.Accuiel de Kriss Nature, panic faux-lycopode, Panicum lycopodioides The specific epithet "lycopodioides" means "similar to Lycopodium" in reference to the plant's general habitus superficially resembling certain species of club-moss. Stems grow horizontally, branching frequently, thus forming mats pressed against the ground. Leaves are small, pressed against the stem like the scales of Lycopodium.Bory, Jean Baptiste Georges Geneviève Marcellin, in Nees von Esenbeck, Christian Gottfried Daniel. Flora Brasiliensis seu Enumeratio Plantarum 2(1): 236. 1829.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial or subshrub

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatemontane tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panicum lycopodioides has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLNC_036121.1 ↗138 954 bpReunion · 2013

ACGT

CCCAATATCCTGTTGGAACAAGATATTGGGTATTTCTGGCTTTCCTTCCTTCAAAAATTCCTATATGTTAGTAGAAAAACCTTATCCATT …

Panicum lycopodioides voucher GB04-2013 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor23

Museum / vouchered3

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 6>10 km 2

8 georeferenced · 15 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
KMCClocation not on record	3

1 institutions · 3 of 3 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)