Panicum effusum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Panicum

At a glance

Occurrence records17 125

Data sources9

Biological traits37

DNA specimens7

eDNA detections6

Sources9 archives

Databases and archives Panicum effusum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF17 125 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

A large area of Panicum effusum Panicum effusum, commonly known as hairy panic, is a grass native to inland Australia. It occurs in every mainland state, as well as New Guinea. In dry conditions, the fast-growing grass can become a tumbleweed.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Leaf length134 mm

Leaf length max1 mm

Leaf length min0.5 mm

Leaf mass55.1 mg

Leaf mass per area71.07 g/m2

Leaf size414 mm²

Leaf width4.88 mm

Leaf width max6 mm

Leaf width min2 mm

Plant height0.5 m

⚠ sources differ — AusTraits: 0.5 m · TRY: 0.18 m

Plant height max1 m

Plant height min0 m

Seed mass0.532 mg

⚠ sources differ — TRY: 0.532 mg · AusTraits: 0.513 mg · GIFT: 0.57 mg

Seed mass max0.908 mg

Seed mass min0.36 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timeyyyyynnnnyyy

Life formperennial

Life spanbiennial/shortlived perennial

⚠ sources differ — TRY: biennial/shortlived perennial · AusTraits: perennial · GIFT: perennial

Pollination syndromeabiotic

Raunkiær life formhemicryptophyte

Resprouting capacitypartial_resprouting

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid

Leaf compoundnesssimple

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Specific leaf area (SLA)12.45 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panicum effusum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK330928.1 ↗620 bpAustralia

ACGT

GTCGTGACCCTTAAACAAAATAGACCGTGAACATGTCATCCATGTCGTCGGGCTACGGTCCGGCTAAGGCCCCCCACCTTCGTTTCGTTG …

Panicum effusum voucher EJT916-BRI internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL2★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type17 125 records

Wild obs. + sensor12 540

Museum / vouchered2 088

Cultivated / captive5

Other2 492

Origin

Native599

Introduced1

Range

Area of Occupancy AOO38 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 11 237≤1 km 780≤10 km 228>10 km 24

12 269 georeferenced · 271 without coordinates

Open the mapobservation + sensor12 540

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 594≤1 km 239≤10 km 765>10 km 319

1 917 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence2 088

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	601
Mount Annan, AU	330
Canberra, AU	280
Adelaide, AU	225
NSW Dept of Planning, Industry and Environmentlocation not on record	148
Museo Entomologico de Leonlocation not on record	139
Palmerston, AU	106
Kensington, AU	49
NSW Office of Environment and Heritagelocation not on record	44
Armidale, AU	41
Smithfield, AU	24
John T. Waterhouse Herbariumlocation not on record	13
Kew, GB	11
James Cook Townsvillelocation not on record	6
State Herbarium of South Australialocation not on record	5
Hobart, AU	5
Pretoria, ZA	4
Bloomington, US	4
Logan, US	3
Auckland, NZ	3
Wollongong, AU	3
Saint Louis, US	3
EL PASO, US	2
University of Stellenboschlocation not on record	2
Parkville, AU	2
Wuzhou, CN	2
South Kensington, GB	1
MeiseBGlocation not on record	1
Beijing, CN	1
GB	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Christchurch, NZ	1
DOI/NPS, Greenbelt Parklocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Batemans Bay, AU	1
La Trobe Universitylocation not on record	1

36 institutions · 2 065 of 2 088 vouchered records shown · 23 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Panicum effusum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 11.9–17.8

Seasonal swing summer↔winter11.1 °C

Max temp (day)21.2 °C 16.5–22.9

Min temp (night)10.2 °C 8.00–13.5

Precipitation30.1 mm/mo 19.7–35.8

Air humidity56.5 % 51.9–58.1

Moisture balance-72.6 mm/mo -114–-20.3

Vapour deficit861 Pa 587–910

Wind speed3.40 m/s 3.00–4.00

Cloud cover15.0 % 13.8–21.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Panicum effusum

At a glance

Sources9 archives

Size & morphology15

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry3

Other traits1

At a glance

Record type17 125 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 125 records