Panicum dichotomiflorum
Michx. · speciesAt a glance
Occurrence records20 472
Data sources15
Biological traits121
DNA specimens36
eDNA detections27
Sources15 archives
Databases and archives Panicum dichotomiflorum's data was compiled from.
WikipediaWikimedia Foundation8 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility20 439 records↗
OBISOcean Biodiversity Information System33 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources121 traits
Chemical compositionLOTUS · NPASS30 compounds
Occurrence & distributionGBIF · OBIS20 472 records
Environmental DNA2 datasets · 5 countries27 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GoaT1.7 Gbp
01Narrative
Panicum dichotomiflorum, known by the common names fall panicgrass, autumn millet (Britain and Ireland), and fall panicum is a species of Poaceae "true grass". It is native to much of the eastern United States and parts of Canada, and it can be found in the Western United States through California. It may be an introduced species in some western climates.Grass Manual Treatment It grows in many types of habitat, including disturbed areas and chaparral habitats.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVPUSDA
Size & morphology17
Leaf length max185 mm
Leaf width4 mm
Plant height0.7 m
⚠ sources differ — GIFT: 0.7 m · USDA: 1.01 m · TRY: 1.0 m
Plant height max1 m
Plant height min0.3 m
Seed length1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass0.52 mg
⚠ sources differ — TRY: 0.52 mg · LEDA: 0.514 mg · GIFT: 0.731 mg
Seed mass max0.53 mg
Seed mass min0.514 mg
Seed volume0.71 mm³
Seed volume max0.71 mm³
Seed volume min0.71 mm³
Seed width0.8 mm
Seed width max0.8 mm
Seed width min0.8 mm
Life cycle & reproduction31
After harvest regrowth rateSlow
Bloom periodSummer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typehuman
Flower colourgreen
Flower conspicuousNo
Flowering endOct
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formannual or perennial
Life spanannual
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment28
Active growth periodSummer and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colouryellow
Fruit fleshinessdry
Growth formherb
Growth form USDABunch
Habitat GIFTÁrea Antrópica, Campo de Várzea, Campo Limpo, Cerrado (lato sensu), Floresta de Igapó, Restinga, Savana Amazônica, Vegetação Aquática
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min6 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceHigh
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min100 days
Leaf C:N ratio20.75 g/g
Leaf c401 mg/g
Leaf dry-matter content (LDMC)217 mg/g
Leaf n19.49 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Photosynthetic pathwayC4
Precipitation max65 in
Precipitation min20 in
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max7 pH
Soil pH min4.8 pH
Specific leaf area (SLA)20 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound392 000 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typepart of infructescence
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition30 compounds
Compounds documented for Panicum dichotomiflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Eudesmane sesquiterpenoids10
Germacrane sesquiterpenoids9
Thujane monoterpenoids1
Camphane monoterpenoids1
Acyclic monoterpenoids1
Documented compounds30 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-alpha-Thujone | present | NPASS | |
| (1R)-2,2,4-trimethyl-5-oxocyclohex-3-ene-1-carboxylic acid | present | NPASS | |
| (1S,2S,4aR,5R,8aS)-4a-methyl-8-methylidene-2-prop-1-en-2-yl-1,2,3,4,5,6,7,8a-octahydronaphthalene-1,5-diol | present | NPASS | |
| (1S,3R,5S)-3-hydroxy-7,7-dimethyl-2-methylidenebicyclo[3.1.1]heptan-6-one | present | NPASS | |
| (3S)-3-methyl-5-[(1R,2R,4S)-1,3,3-trimethyl-7-oxabicyclo[2.2.1]heptan-2-yl]pent-1-en-3-ol | present | NPASS | |
| (3S,3'S,3aR,4S,4'R,5'S,6S,8'R,9'E,10E,11aR)-3',4-dihydroxy-3,5',10,10'-tetramethylspiro[3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-6,15'-7,14-dioxatricyclo[11.4.0.04,8]heptadeca-1(13),9-diene]-2,6',7-trione | present | NPASS | |
| (3S,3aR,4S,10E,11aR)-4-hydroxy-3,10-dimethyl-6-methylidene-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2,7-dione | present | NPASS | |
| (3S,3aR,4S,5aR,6R,9aS,9bR)-4,6-dihydroxy-3,5a,9-trimethyl-3,3a,4,5,6,7,9a,9b-octahydrobenzo[g][1]benzofuran-2-one | present | NPASS | |
| (3S,3aR,4S,5aR,6R,9aS,9bR)-4,6-dihydroxy-3,5a-dimethyl-9-methylidene-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one | present | NPASS | |
| (3S,3aR,4S,5Z,7S,10E,11aR)-4,7-dihydroxy-3,6,10-trimethyl-3a,4,7,8,9,11a-hexahydro-3H-cyclodeca[b]furan-2-one | present | NPASS |
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panicum dichotomiflorum has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes10
GenBank sequences10
eDNA detections27
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCCAA …
Panicum dichotomiflorum voucher WC-78WP 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★ITS2★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Panicum dichotomiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 696 830 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Panicum dichotomiflorum1.7 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 54 n = 27
Ploidy6× hexaploid · measured
Chromosome records36–542n range54median54mode20records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5418×GoaT · Kew Plant DNA C-values Database · CCDB · croinout · CCDB · iber-fl +5
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · croinout — Church, G. L. 1929
CCDB · croinout — Gould, F. W. 1958
CCDB · croinout — Gould, F. W. 1968
CCDB · croinout — Devesa, J. A., Ruz, T., Viera, M. C., Tormo, R., Vzquez, F. et al. 1991
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). III. Devesa, J. A. & al.Bol. Soc. Brot. ser. 264: 35-74(1991).
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1983. Chromosome numbers in Adoxaceae, Chloranthaceae, Cupressaceae, Juncaceae, Poaceae. Bot. Zhurn. SSSR 68 (12): 1683.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, M. C. Viera, R. Tormo, F. Vázquez, J. P. Carrasco, A. Ortega & J. Pastor. 1991. Contribución al conocimiento cariológico de las Poaceae en Extremadura (España)---III. Bol. Soc. Brot., sér. 2 64: 35–74.
CCDB · ipcn-api-dl — Hamoud, M. A., S. A. Haroun, R. D. Macleod & A. J. Richards. 1994. Cytological relationships of selected species of Panicum L. Biol. Pl. 36: 37–45.
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-fedorov — Church 1929b
CCDB · book-fedorov — Gould 1958
CCDB · kew — Bennett MD, Leitch IJ, Hanson L. 1998. DNA amounts in two samples of angiosperm weeds. Annals of Botany 82 (Supplement A): 121-134.
CCDB · CromoCat 2015 — Devesa, J. A., Ruíz, T., Viera, M., Tormo, R., Vázquez, F., Carrasco, J., Ortega, A. & Pastor, J. (1991). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). III. Bol. Soc. Brot. 64: 35-74.
CCDB · CromoCat 2015 — Hamoud, M. A., Haroun, S. A., Macleod, R. D. & Richards, A. J. (1994). Cytological relationships of selected species of Panicum L. Biologia Plantarum 36: 37-45
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Probatova, N. S. & A. P. Sokolovskaya. (1983). New chromosome numbers for vascular plants from the Islands of Peter the Great Bay (Primorye Territory). J. Bot. URSS 68(12): 1655-1662.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
2n 362×CCDB · croinout · CCDB · book-fedorov
CCDB · croinout — Brown, W. V. 1948
CCDB · book-fedorov — Brown w. v. 1948
2n 552×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
n 181×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — DAVIDSE, G., & R.W. POHL. 1974. Chromosome numbers, meiotic behavior, and notes on tropical American grasses (Gramineae). Canad. J. Bot. 52: 317-328.
n 271×CCDB · Cave1958
CCDB · Cave1958 — Gould 1958
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~1.75 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.75 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type20 472 records
Wild obs. + sensor14 894
Museum / vouchered5 275
Cultivated / captive1
Other302
Origin
Native167
Introduced17
Range
Area of Occupancy AOO44 060 km²
Depth
0–200 m sunlit6
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1 m · max 1 m · 6 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy23% within 1 km
≤100 m 1 859≤1 km 654≤10 km 8 449>10 km 168
11 130 georeferenced · 3 764 without coordinates
Open the mapobservation + sensor14 894
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 268≤1 km 561≤10 km 817>10 km 127
1 773 georeferenced · 3 502 without coordinates
Open the institutions mapphysical evidence5 275
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions180 of 343 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 236 |
| Philadelphia, US | 202 |
| Wuzhou, CN | 201 |
| Saint Louis, US | 175 |
| Sanda, JP | 171 |
| Chongqing Museumlocation not on record | 165 |
| Odawara, JP | 152 |
| International Salmonella Centre (W.H.O.)location not on record | 146 |
| Québec, CA | 99 |
| University of Stellenboschlocation not on record | 96 |
| Nagano City, JP | 95 |
| BIO-UNIPIlocation not on record | 87 |
| Chiba, JP | 80 |
| Provincia di Livornolocation not on record | 74 |
| San Isidro, AR | 72 |
| MeiseBGlocation not on record | 68 |
| Burlington, US | 58 |
| Davis, US | 55 |
| Williamsburg, US | 53 |
| Kochi, JP | 53 |
| Emporia, US | 51 |
| Auckland, NZ | 45 |
| Brussel, BE | 43 |
| Jena Microbial Resource Collectionlocation not on record | 43 |
| Fort Worth, US | 42 |
| Corrientes, AR | 42 |
| Université de Bordeauxlocation not on record | 42 |
| Miami, US | 42 |
| GJOlocation not on record | 42 |
| Austin, US | 41 |
| Tokushima, JP | 41 |
| Kew, GB | 37 |
| New Haven, US | 35 |
| UFMSlocation not on record | 35 |
| Logan, US | 32 |
| Zürich, CH | 32 |
| BDBClocation not on record | 31 |
| Allentown, US | 31 |
| Toyama, JP | 29 |
| US | 29 |
| Ann Arbor, US | 29 |
| Bando, JP | 28 |
| Puerto Ayora, EC | 27 |
| Tampa, US | 25 |
| Columbia, US | 25 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 24 |
| National Institute of Biological Resourceslocation not on record | 24 |
| Salzburg, AT | 23 |
| KURAlocation not on record | 22 |
| Madison, US | 22 |
| Jackson, US | 22 |
| Brasília, BR | 21 |
| Tomioka, JP | 21 |
| Kawasaki Shi Tama Ku, JP | 20 |
| Akita Prefectural Museumlocation not on record | 19 |
| Moscow State Universitylocation not on record | 19 |
| Shinshu Universitylocation not on record | 18 |
| Ciudad Autónoma de Buenos Aires, AR | 18 |
| Tsukuba, JP | 18 |
| Green Bay, US | 18 |
| Hiratsuka City Museumlocation not on record | 18 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 17 |
| GZUlocation not on record | 17 |
| Wlocation not on record | 17 |
| Christchurch, NZ | 16 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 16 |
| Fukushima Universitylocation not on record | 16 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 16 |
| College Park, US | 15 |
| Fundación Miguel Lillolocation not on record | 15 |
| KIWElocation not on record | 15 |
| Mississippi State, US | 15 |
| Otaru, JP | 15 |
| CICYTEXlocation not on record | 15 |
| Canadian Department of Agriculturelocation not on record | 15 |
| GB | 15 |
| Staten Island, US | 14 |
| Claremont, US | 14 |
| Saint John, CA | 14 |
| WTUlocation not on record | 14 |
| BFLlocation not on record | 14 |
| CJBGlocation not on record | 14 |
| Norfolk, US | 14 |
| Nijmegen, NL | 14 |
| Pittsburg, US | 13 |
| IDElocation not on record | 13 |
| BAYLUlocation not on record | 13 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 12 |
| Denver, US | 12 |
| Wellington, NZ | 12 |
| Chapel Hill, US | 12 |
| UnBlocation not on record | 12 |
| Flagstaff, US | 12 |
| Barcelona, ES | 12 |
| J.F.Oberlin Universitylocation not on record | 12 |
| Millersville, US | 11 |
| Philadelphia, US | 11 |
| Glocation not on record | 11 |
| DMZ botanic gardenlocation not on record | 11 |
| Rotorua, NZ | 11 |
| Sendai, JP | 11 |
| Acadia Universitylocation not on record | 10 |
| Parthenon Tama History Museumlocation not on record | 10 |
| Dekalb, US | 10 |
| Montréal, CA | 10 |
| University of Southern Mississippilocation not on record | 9 |
| Tall Timbers Research Stationlocation not on record | 9 |
| Clemson, US | 9 |
| Zürich, CH | 9 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| Cenargenlocation not on record | 9 |
| Castelar, AR | 9 |
| CEPLAClocation not on record | 9 |
| Chicago, US | 9 |
| Helsinki, FI | 9 |
| NoColllocation not on record | 9 |
| Sagamihara, JP | 8 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 8 |
| Nagatoro-machi, Chichibu-gun, JP | 8 |
| Knoxville, US | 8 |
| Moscow, US | 8 |
| ASUlocation not on record | 8 |
| San Angelo, US | 8 |
| CJBNlocation not on record | 8 |
| McWane Science Centerlocation not on record | 8 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 8 |
| Kirksville, US | 7 |
| Salvador, BR | 7 |
| Brasília, BR | 7 |
| EL PASO, US | 7 |
| JP | 7 |
| Laboratorio de Ictiologialocation not on record | 7 |
| SIHUlocation not on record | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Badajoz, ES | 7 |
| Xiamen, CN | 7 |
| Riverside, US | 7 |
| NSMKlocation not on record | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| Toronto, CA | 7 |
| UEMlocation not on record | 7 |
| Angwin, US | 6 |
| KR | 6 |
| San Diego, US | 6 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 6 |
| BRNUlocation not on record | 6 |
| Salamanca, ES | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 6 |
| Bangkok, TH | 6 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 6 |
| Chicago, US | 6 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 6 |
| Valdosta State Universitylocation not on record | 6 |
| UFERSAlocation not on record | 6 |
| Whitewater, US | 6 |
| Durham, US | 6 |
| Bern, CH | 6 |
| JBRJlocation not on record | 6 |
| KOMlocation not on record | 6 |
| Fortaleza, BR | 6 |
| US | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Nishihara, JP | 6 |
| Federal University of Espírito Santolocation not on record | 6 |
| UFESlocation not on record | 6 |
| Ishikawa Museum of Natural Historylocation not on record | 6 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 6 |
| Mexico City, MX | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| Beijing Normal Universitylocation not on record | 5 |
| Universidade Federale do Rio Grande do Sullocation not on record | 5 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 5 |
| Plocation not on record | 5 |
| Davenport, US | 5 |
| Asheville, US | 5 |
| Paleontological Collectionlocation not on record | 5 |
| BClocation not on record | 5 |
| Cuiabá, BR | 5 |
| Mlocation not on record | 5 |
| Beijing, CN | 5 |
| DanBIFlocation not on record | 5 |
| H-Meierottlocation not on record | 5 |
| Vancouver, CA | 5 |
| Washington, US | 4 |
| Lincoln, US | 4 |
| Phoenix, US | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Iwate Prefectural Museumlocation not on record | 4 |
| PrivatHerblocation not on record | 4 |
| H-Hohlalocation not on record | 4 |
| Dover, US | 4 |
| Boise, US | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Cheney, US | 4 |
| Henderson, US | 4 |
| Turku, FI | 4 |
| La Paz, BO | 4 |
| Natural History Museum Rotterdamlocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| MAlocation not on record | 4 |
| Feira de Santana, BR | 4 |
| Springfield, US | 4 |
| Fayetteville, US | 4 |
| Osaka, JP | 4 |
| Durham, US | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| CASlocation not on record | 3 |
| Berlin, DE | 3 |
| Bend, US | 3 |
| Macomb, US | 3 |
| UNICAMPlocation not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Taipei, TW | 3 |
| Hobart, AU | 3 |
| Laboratory of Palaeontologylocation not on record | 3 |
| Pretoria, ZA | 3 |
| UEPAlocation not on record | 3 |
| Chicago, US | 3 |
| Lubbock, US | 3 |
| GAlocation not on record | 3 |
| UFSClocation not on record | 3 |
| PUC-RSlocation not on record | 3 |
| Córdoba, ES | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Université Lavallocation not on record | 3 |
| ZRC-SAZUlocation not on record | 3 |
| St. Paul, US | 3 |
| Santa Barbara, US | 2 |
| Cambridge, US | 2 |
| Victoria, CA | 2 |
| Dresden, DE | 2 |
| Edmonton, CA | 2 |
| Guasave, MX | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Tilburg, NL | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| IECOSlocation not on record | 2 |
| Universidade Federal de Goiáslocation not on record | 2 |
| Londrina, BR | 2 |
| Pamplona, ES | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Northridge, US | 2 |
| Institute of Ecology of the Volga river basin of Russian Academy of Sciences | IEVB RASlocation not on record | 2 |
| Durango, MX | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| TAIElocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Vitoria, ES | 2 |
| Jefferson City, US | 2 |
| Criciúma, BR | 2 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 2 |
| UNESClocation not on record | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| UNEMATlocation not on record | 2 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 2 |
| Corvallis, US | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Lausanne, CH | 2 |
| New Brunswick, US | 2 |
| Museum of the Rockieslocation not on record | 2 |
| South Kensington, GB | 2 |
| Oswego, US | 2 |
| State University of New York, College at Oneontalocation not on record | 2 |
| Pocatello, US | 2 |
| Albuquerque, US | 2 |
| Caldwell, US | 2 |
| Provo, US | 2 |
| DNSMlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Due West, US | 1 |
| Long Beach, US | 1 |
| Keene State Universitylocation not on record | 1 |
| ISAlocation not on record | 1 |
| Missoula, US | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Kuopio, FI | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| St. Augustine, TT | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Stephenville, US | 1 |
| Richmond, US | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Altos de Pipe, VE | 1 |
| València, ES | 1 |
| DULlocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Masindi, UG | 1 |
| University of Alberta Museumslocation not on record | 1 |
| LDlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Ashland, US | 1 |
| Fairfax, US | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Denton, US | 1 |
| Bloomington, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| sonstHerblocation not on record | 1 |
| Stockholm, SE | 1 |
| Aarhus, DK | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Instituto de Pesquisas Ambientaislocation not on record | 1 |
| Mazatlán, MX | 1 |
| Universidade Federal de Pelotaslocation not on record | 1 |
| University of Bayreuthlocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| H-Diewaldlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Granada, ES | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| SJNAlocation not on record | 1 |
| Mount Berry, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| BAlocation not on record | 1 |
| Whitehorse, CA | 1 |
| University of Nevada, Museum of Biologylocation not on record | 1 |
| UMKClocation not on record | 1 |
| UFPElocation not on record | 1 |
| Paris, FR | 1 |
| IPA/SPlocation not on record | 1 |
| SCZlocation not on record | 1 |
| Johnson City, US | 1 |
| BMlocation not on record | 1 |
| Nishihara, JP | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| AUAlocation not on record | 1 |
| Mérida, MX | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| San José, CR | 1 |
| University of Central Missourilocation not on record | 1 |
| Conway, US | 1 |
343 institutions · 4 985 of 5 275 vouchered records shown · 254 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Panicum dichotomiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 12.6–24.4
Seasonal swing summer↔winter26.7 °C
Max temp (day)21.6 °C 16.4–27.9
Min temp (night)13.5 °C 7.40–20.9
Precipitation112 mm/mo 76.7–292
Air humidity61.1 % 58.0–64.2
Moisture balance21.7 mm/mo -61.8–154
Vapour deficit754 Pa 671–1,124
Wind speed2.90 m/s 2.60–4.00
Cloud cover38.9 % 35.6–50.2
CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.