Panicum capillare
speciesAt a glance
Occurrence records28 723
Data sources12
Biological traits59
DNA specimens73
eDNA detections32
Sources12 archives
Databases and archives Panicum capillare's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility28 723 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics73 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources59 traits
Occurrence & distributionGBIF28 723 records
Environmental DNA1 datasets · 7 countries32 detections
DNA & barcodingBOLD · NCBI73 specimens
Genome at a glanceCCDB440 Mbp
01Narrative
Panicum capillare est une espèce de plantes monocotylédones de la famille des Poaceae, sous-famille des Panicoideae, originaire d'Amérique du Nord. C'est une plante herbacée annuelle, cespiteuse, aux tiges dressées ou géniculées pouvant atteindre 20 à 80 cm de haut. C'est, en Amérique du Nord, une mauvaise herbe des cultures dont une population résistante à l'atrazine a été signalée en 1981 au Canada. Elle a été introduite et s'est naturalisée en Europe, où on l'a importée comme plante ornementale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVP
Size & morphology21
Inflorescence length max50 cm
Inflorescence length min15 cm
Leaf length200 mm
Leaf length max300 mm
Leaf length min70 mm
Leaf width15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 6 mm
Leaf width max18 mm
Leaf width min5 mm
Plant height0.2 m
⚠ sources differ — GIFT: 0.2 m · AusTraits: 0.8 m · TRY: 0.45 m
Plant height generative0.604 m
Plant height max1.2 m
Plant height min0.1 m
Seed length1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass0.278 mg
⚠ sources differ — TRY: 0.278 mg · LEDA: 0.427 mg · GIFT: 0.344 mg
Seed mass max0.65 mg
Seed mass min0.173 mg
Seed volume0.26 mm³
Seed volume max0.26 mm³
Seed volume min0.26 mm³
Life cycle & reproduction13
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Flowering timeyynnnnnnnnny
Life formannual
Life spanannual
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typeandromonoecious
⚠ sources differ — AusTraits: andromonoecious · GIFT: bisexual
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Habitat GIFTÁrea Antrópica
Leaf formelliptic
Mycorrhiza typeAMNM
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio24.83 g/g
Leaf c427 mg/g
Leaf dry-matter content (LDMC)294 mg/g
Leaf n19.25 mg/g
Photosynthetic pathwayC4
Specific leaf area (SLA)21.44 mm²/mg
⚠ sources differ — TRY: 21.44 mm²/mg · LEDA: 27 mm²/mg · GIFT: 28.77 mm²/mg
Other traits4
Diaspore typefruit with appendage
Inflorescencepanicle
Seeds per fruit101-1000
Shoot orientationascending
05DNA & barcoding73 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panicum capillare has left across the world's sequence archives.
At a glance
DNA specimens73
Marker genes11
GenBank sequences10
eDNA detections32
Countries7
The DNA barcodea real sequence read deposited for this species
CCTGCGGAAGGATCATTGTCGTGACCCTTAAACAAAACAGACCGTGAACGTGTCATCCATGTCGTCAGGCTACTGTCTGACCAAGGCCCC …
Panicum capillare voucher 510140 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★trnL-F★ITS4★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Panicum capillare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size440 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Panicum capillare0.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–182n range18median18mode21records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1821×CCDB · slov-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +3
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Murín A., Svobodová Z., Májovský J. & Feráková V., 1999: Chromosome numbers of some species of the Slovak flora. - Thaiszia - J. Bot., Košice 9/1: 31-40.
CCDB · slov-fl — Feráková V. & Schwarzová T., 1974: K problematike cytotaxonomického výskumu synantropných druhov v ČSSR. - Acta Inst. Bot. Acad. Sci. Slov. 1: 41-50.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4686
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Hamoud, M. A., S. A. Haroun, R. D. Macleod & A. J. Richards. 1994. Cytological relationships of selected species of Panicum L. Biol. Pl. 36: 37–45.
CCDB · ipcn-api-dl — Krahulcová, A. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Murín, A., Z. Svobodová, J. Májovský & V. Feráková. 1999. Chromosome numbers of some species of the Slovak flora. Thaiszia 9(1): 31–40.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981a. In Chromosome number reports LXXI. Taxon 30: 509–511.
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-ipcn67-71 — SPELLENBERG, R. 1970. In IOPB chromosome number reports xxv. Taxon 19: 102-113.
CCDB · book-atlas-flowering-plants — Avdulov 1928
CCDB · CromoCat 2015 — Hamoud, M. A., Haroun, S. A., Macleod, R. D. & Richards, A. J. (1994). Cytological relationships of selected species of Panicum L. Biologia Plantarum 36: 37-45
CCDB · CromoCat 2015 — Kiehn, M., Vitek, E., Hellmayr, E., Walter, J., Tschenett, J., Justin, C. & Mann, M. (1991). Beiträge zur Flora von Österreich: Chromosomenzählungen. Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 128: 19-39
CCDB · CromoCat 2015 — Krahulcová, A. (1992). In. J. Mesicek & Javurková-Jarolímová, List of chromosome numbers of the Czech Vascular Plants Academia, Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Murín, A. (1993). Karyologické štúdium okrasnych rastlín flóry Slovenska. Biologia 48: 441-445.
CCDB · CromoCat 2015 — Murín, A., Z. Svobodová, J. Májovský & V. Feráková (1999). Chromosome numbers of some species of the Slovak flora Thaiszia 9(1): 31-40
CCDB · CromoCat 2015 — Spellenberg, R. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXV]. Taxon 19(1): 112-113.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 509-511.
n 94×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1
CCDB · ipcn-api-dl — Vahidy, A. A., G. Davidse & Y. Shigenobu. 1987. Chromosome counts of Missouri Asteraceae and Poaceae. Ann. Missouri Bot. Gard. 74(2): 432–433.
CCDB · book-ipcn67-71 — SPELLENBERG, R. 1967. In Documented chromosome numbers of plants. Madrono 19: 134="136.
CCDB · book-ipcn75-78 — Reeder 1977
CCDB · CromoCat 2015 — Vahidy, A. A., G. Davidse & Y. Shigenobu (1987). Chromosome counts of Missouri Asteraceae and Poaceae. Annals of the Missouri Botanical Garden 74: 432-433
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type28 723 records
Wild obs. + sensor21 929
Museum / vouchered6 090
Cultivated / captive1
Other703
Origin
Native19
Introduced1 117
Range
Area of Occupancy AOO57 732 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy35% within 1 km
≤100 m 5 251≤1 km 1 355≤10 km 12 184>10 km 194
18 984 georeferenced · 2 945 without coordinates
Open the mapobservation + sensor21 929
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 562≤1 km 1 008≤10 km 1 197>10 km 189
2 956 georeferenced · 3 134 without coordinates
Open the institutions mapphysical evidence6 090
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 1
1 georeferenced
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions195 of 341 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 301 |
| International Salmonella Centre (W.H.O.)location not on record | 227 |
| Provincia di Livornolocation not on record | 158 |
| Chongqing Museumlocation not on record | 157 |
| Philadelphia, US | 129 |
| Québec, CA | 119 |
| BIO-UNIPIlocation not on record | 118 |
| Spearfish, US | 111 |
| Saint Louis, US | 102 |
| Claremont, US | 101 |
| Davis, US | 95 |
| Riverside, US | 93 |
| Fort Worth, US | 90 |
| Ann Arbor, US | 84 |
| Flagstaff, US | 84 |
| LDlocation not on record | 79 |
| San Diego, US | 72 |
| SLU Artdatabankenlocation not on record | 70 |
| Helsinki, FI | 70 |
| Logan, US | 69 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 69 |
| Montréal, CA | 63 |
| Emporia, US | 63 |
| Albuquerque, US | 62 |
| MeiseBGlocation not on record | 62 |
| Denver, US | 61 |
| ASUlocation not on record | 60 |
| Chapel Hill, US | 58 |
| Austin, US | 58 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 58 |
| Toronto, CA | 53 |
| Canadian Department of Agriculturelocation not on record | 52 |
| University of Stellenboschlocation not on record | 49 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 46 |
| Lincoln, US | 43 |
| Victoria, CA | 43 |
| New Haven, US | 43 |
| University of New Hampshirelocation not on record | 42 |
| Université Lavallocation not on record | 42 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 40 |
| Brussel, BE | 39 |
| Moscow, US | 38 |
| GJOlocation not on record | 36 |
| Wuzhou, CN | 36 |
| Auckland, NZ | 36 |
| Missoula, US | 35 |
| Museo Entomologico de Leonlocation not on record | 35 |
| Mount Annan, AU | 34 |
| BFLlocation not on record | 33 |
| Santa Barbara, US | 32 |
| Moscow State Universitylocation not on record | 32 |
| Adelaide, AU | 32 |
| St. Paul, US | 31 |
| Salzburg, AT | 30 |
| Madison, US | 30 |
| Green Bay, US | 30 |
| Bozeman, US | 29 |
| DOI/NPS, Greenbelt Parklocation not on record | 28 |
| Acadia Universitylocation not on record | 28 |
| Pittsburg, US | 26 |
| BDBClocation not on record | 26 |
| Barcelona, ES | 26 |
| Nijmegen, NL | 24 |
| GZUlocation not on record | 24 |
| Adam Mickiewicz University in Poznańlocation not on record | 24 |
| Allentown, US | 24 |
| Mississippi State, US | 24 |
| Lubbock, US | 24 |
| BAYLUlocation not on record | 23 |
| Canberra, AU | 23 |
| Caldwell, US | 22 |
| San Isidro, AR | 22 |
| Entomological Society of Latvialocation not on record | 22 |
| Oskarshamn, SE | 22 |
| Bloomington, US | 22 |
| Saint John, CA | 21 |
| Boise, US | 20 |
| EL PASO, US | 20 |
| McWane Science Centerlocation not on record | 20 |
| Tampa, US | 20 |
| Turku, FI | 19 |
| Odawara, JP | 18 |
| WTUlocation not on record | 18 |
| Görlitz, DE | 18 |
| Phoenix, US | 17 |
| Christchurch, NZ | 17 |
| Burlington, US | 17 |
| San Luis Obispo, US | 16 |
| Arcata, US | 16 |
| Pocatello, US | 16 |
| Mlocation not on record | 16 |
| Otaru, JP | 15 |
| Uppsala, SE | 15 |
| BClocation not on record | 15 |
| València, ES | 15 |
| Olocation not on record | 15 |
| Bern, CH | 14 |
| Jackson, US | 14 |
| Frauenfeld, CH | 14 |
| Whitewater, US | 14 |
| Wlocation not on record | 14 |
| Paris, FR | 13 |
| Davenport, US | 13 |
| US | 13 |
| Dekalb, US | 13 |
| South Kensington, GB | 13 |
| WINlocation not on record | 13 |
| Staten Island, US | 13 |
| DBF-NHMDlocation not on record | 12 |
| Vancouver, CA | 12 |
| San Angelo, US | 12 |
| Corvallis, US | 12 |
| CASlocation not on record | 12 |
| Millersville, US | 11 |
| Provo, US | 11 |
| Kensington, AU | 11 |
| Williamsburg, US | 11 |
| PRClocation not on record | 11 |
| Dresden, DE | 10 |
| University of Guelph, OAC Herbariumlocation not on record | 10 |
| Pullman, US | 10 |
| Uniwersytet Jagiellońskilocation not on record | 10 |
| Frankfurt am Main | 10 |
| Philadelphia, US | 10 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 10 |
| Karlsruhe, DE | 9 |
| US | 9 |
| Salamanca, ES | 9 |
| US | 9 |
| CJBGlocation not on record | 9 |
| USFSlocation not on record | 8 |
| MAlocation not on record | 8 |
| IDElocation not on record | 8 |
| H-Hohlalocation not on record | 8 |
| Henderson, US | 8 |
| Chicago, US | 8 |
| Oulu, FI | 8 |
| Keene State Universitylocation not on record | 8 |
| Rotorua, NZ | 8 |
| Northridge, US | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Tsukuba, JP | 7 |
| Ciudad Autónoma de Buenos Aires, AR | 7 |
| Vitoria, ES | 7 |
| Portland, US | 7 |
| Durango, US | 7 |
| GB | 7 |
| Denton, US | 7 |
| Tempe, US | 6 |
| Cheney, US | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| PrivatHerblocation not on record | 6 |
| University of Alberta Museumslocation not on record | 6 |
| University of Winnipeglocation not on record | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Chicago, US | 5 |
| Brisbane, AU | 5 |
| Trois-Rivières, CA | 5 |
| Lausanne, CH | 5 |
| Wellington, NZ | 5 |
| Bend, US | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Museum of the Rockieslocation not on record | 5 |
| KMNlocation not on record | 5 |
| USFS/BHSClocation not on record | 5 |
| Tilburg, NL | 5 |
| Los Angeles, US | 5 |
| Durango, MX | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Berlin, DE | 5 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 5 |
| Science Museum of Minnesotalocation not on record | 5 |
| Pamplona, ES | 5 |
| Morgantown, US | 5 |
| Knoxville, US | 5 |
| Hudson, US | 5 |
| Grand Junction, US | 5 |
| Royal Botanical Gardenslocation not on record | 4 |
| Tartu, EE | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| VALElocation not on record | 4 |
| Ypsilanti, US | 4 |
| Hamilton, US | 4 |
| Mohonk Preservelocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| BRNUlocation not on record | 4 |
| NoColllocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Madrid, ES | 4 |
| Kirksville, US | 4 |
| Zürich, CH | 4 |
| Mexico City, MX | 4 |
| SZUlocation not on record | 4 |
| Hobart, AU | 4 |
| Tacoma, US | 4 |
| Porrentruy, CH | 4 |
| State Herbarium of South Australialocation not on record | 4 |
| Santa Cruz, US | 4 |
| GAlocation not on record | 3 |
| Bandelier National Monumentlocation not on record | 3 |
| Hermosillo, MX | 3 |
| Sanda, JP | 3 |
| TUR-Alocation not on record | 3 |
| Brookings, US | 3 |
| JP | 3 |
| Zürich, CH | 3 |
| Kew, GB | 3 |
| Nagano City, JP | 3 |
| Orem, US | 3 |
| Eastern Nevada Landscape Coalitionlocation not on record | 3 |
| Pacific Lutheran Universitylocation not on record | 3 |
| Weber State Universitylocation not on record | 3 |
| Armidale, AU | 3 |
| H-AkrKGlocation not on record | 2 |
| Granada, ES | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| College Park, US | 2 |
| Chapingo, MX | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| US | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Xiamen, CN | 2 |
| Pretoria, ZA | 2 |
| Waverly, US | 2 |
| Washington, US | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Durham, US | 2 |
| University of Southern Mississippilocation not on record | 2 |
| La Trobe Universitylocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Mount Berry, US | 2 |
| Oswego, US | 2 |
| Pamplona, ES | 2 |
| Jefferson City, US | 2 |
| Corrientes, AR | 2 |
| Beijing, CN | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| LINUlocation not on record | 2 |
| State University of New York, College at Oneontalocation not on record | 2 |
| Irvine, US | 2 |
| Tomioka, JP | 2 |
| Macomb, US | 2 |
| San Jose, US | 2 |
| Alicante, ES | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Torreón, MX | 2 |
| CJBNlocation not on record | 2 |
| Stockholm, SE | 2 |
| Kingston, US | 2 |
| Clemson, US | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Ashland, US | 2 |
| Bangkok, TH | 2 |
| Clarksville, US | 1 |
| Montréal, CA | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Chiba, JP | 1 |
| Stephenville, US | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Sagamihara, JP | 1 |
| QAUlocation not on record | 1 |
| Plocation not on record | 1 |
| AUAlocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| UnBlocation not on record | 1 |
| ISAlocation not on record | 1 |
| Bourges, FR | 1 |
| Kochi, JP | 1 |
| Umeå Universitylocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Conway, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| KNFYlocation not on record | 1 |
| IFR-DNFlocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Fulda, DE | 1 |
| ULBF-AGRlocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Nishihara, JP | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Universität Tübingenlocation not on record | 1 |
| Sapporo, JP | 1 |
| Ensenada, MX | 1 |
| Honolulu, US | 1 |
| KNFHClocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Porvoo, FI | 1 |
| Universität Basel, Herbariumlocation not on record | 1 |
| Toyama, JP | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Kuopio, FI | 1 |
| BGPAlocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Brock University (BU)location not on record | 1 |
| Norfolk, US | 1 |
| Taipei, TW | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Tokushima, JP | 1 |
| Columbia, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| BAlocation not on record | 1 |
| Córdoba, AR | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Tuscaloosa, US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| H-Zimmerlocation not on record | 1 |
| Institute of Ecology of the Volga river basin of Russian Academy of Sciences | IEVB RASlocation not on record | 1 |
| San Sebastián, ES | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Podgorica, ME | 1 |
| Göteborg, SE | 1 |
| Fredericksburg, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Universität Ulmlocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| SEINetlocation not on record | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Conway, US | 1 |
| KURAlocation not on record | 1 |
| CZE082location not on record | 1 |
| GBR016location not on record | 1 |
| Fairfax, US | 1 |
| Springfield, US | 1 |
| DULlocation not on record | 1 |
| Sendai, JP | 1 |
341 institutions · 5 752 of 6 090 vouchered records shown · 334 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA32 detections
Where the DNA of Panicum capillare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found32
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 32 detections have coordinates
Open the map7 countries0
Growing roadside in gravelly soil w/ euphorb…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.7 °C 10.8–20.9
Seasonal swing summer↔winter21.6 °C
Max temp (day)22.9 °C 17.8–26.6
Min temp (night)14.2 °C 5.60–17.2
Precipitation81.1 mm/mo 18.8–104
Air humidity59.6 % 50.7–62.4
Moisture balance-39.6 mm/mo -154–17.7
Vapour deficit850 Pa 609–1,186
Wind speed3.20 m/s 2.00–4.30
Cloud cover39.0 % 20.2–47.9
CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.