Pangasius djambal

Bleeker, 1846 · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Pangasiidae/Pangasius

At a glance

Occurrence records2

Data sources10

Biological traits6

DNA specimens7

eDNA detections0

Sources10 archives

Databases and archives Pangasius djambal's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF2 records

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT · NCBI≈845 Mbp

01Narrative

Pangasius djambal ist eine Fischart aus der Gattung Pangasius innerhalb der Familie der Haiwelse. Die Art kommt im Mekongbecken in Kambodscha, Laos, Vietnam und Thailand sowie in Malaysien und Indonesien vor. Die Art wird vor allem in Indonesien kommerziell befischt und gilt aufgrund ihrer schnellen Wuchses und hohen Proteingehalts als vielversprechender Kandidat für eine Nutzung in der Aquakultur.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length90 cm

Body mass16 000 g

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability56

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pangasius djambal has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Diversity (π)2.6%

Haplotypes2

BINs2

Most divergent pair0.15%

Where individuals differ — all 59 variable positions, in barcode order

49Cmostly conserved

55Cmostly conserved

75Cmostly conserved

79Amostly conserved

94Amostly conserved

118Tmostly conserved

172Amostly conserved

184Tmostly conserved

217Gmostly conserved

220Tmostly conserved

232Cmostly conserved

235Tmostly conserved

247Tmostly conserved

265Tmostly conserved

268Gmostly conserved

284Tmostly conserved

289Tmostly conserved

295Cmostly conserved

304Amostly conserved

310Amostly conserved

334Amostly conserved

337Tmostly conserved

343Cmostly conserved

344Cmostly conserved

346Tmostly conserved

349Tmostly conserved

358Cmostly conserved

370Gmostly conserved

397Cmostly conserved

403Tmostly conserved

404Cmostly conserved

406Tmostly conserved

421Cmostly conserved

430Amostly conserved

439Tmostly conserved

445Tmostly conserved

451Cmostly conserved

460Cmostly conserved

469Amostly conserved

484Amostly conserved

487Tmostly conserved

497Tmostly conserved

508Gmostly conserved

514Cmostly conserved

515Tmostly conserved

529Tmostly conserved

536Tmostly conserved

538Amostly conserved

539Tmostly conserved

550Amostly conserved

556Gmostly conserved

559Tmostly conserved

571Tmostly conserved

577Cmostly conserved

586Tmostly conserved

592Cmostly conserved

610Tmostly conserved

613Tmostly conserved

616Tmostly conserved

CCTCTACCTAGTATTTGGTGCCTGAGCAGGAATAGTTGGTACGGCCCTCAGCCTCCTAATTCGGGCAGAGCTAGCCCAACCCGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pangasianodon gigassame family9.9%Pangasius conchophilussame genus10.0%Pangasius nasutussame genus10.1%Pangasius bocourtisame genus10.6%Pseudolais pleurotaeniasame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pangasius djambal carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈844 539 323 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pangasius djambal0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	1

1 institutions · 1 of 2 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)