Pangaeus bilineatus

(Say, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cydnidae/Pangaeus

At a glance

Occurrence records1 805

Data sources7

Biological traits0

DNA specimens13

eDNA detections10

Sources7 archives

Databases and archives Pangaeus bilineatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 805 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 805 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD13 specimens

01Narrative

Pangaeus bilineatus, the peanut burrower bug, is a species of burrowing bug in the family Cydnidae. It is found in the Caribbean Sea, Central America, and North America. Peanut burrower bug, Pangaeus bilineatus

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pangaeus bilineatus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes2

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

10Cmostly conserved

14Cmostly conserved

40Amostly conserved

85Gmostly conserved

100Gmostly conserved

109Amostly conserved

197Cmostly conserved

205Cmostly conserved

401Cmostly conserved

406Tmostly conserved

533Cmostly conserved

565Gvariable

578Tmostly conserved

622Amostly conserved

625Tmostly conserved

628Avariable

631Amostly conserved

637Amostly conserved

AACCTTATACTTTCTATTTGGAATATGAGCAGGAATAGTAGGAACAGCTATAAGATGAATTATTCGAATTGAACTTGGACAACCGGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes7

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Graphosoma rubrolineatumsame order14.3%Zicrona caeruleasame order14.9%Poecilocoris lewisisame order14.9%Macroscytus fraterculussame family14.9%Odontotarsus purpureolineatussame order14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 805 records

Wild obs. + sensor1 197

Museum / vouchered607

Cultivated / captive1

Range

Area of Occupancy AOO3 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 654≤1 km 135≤10 km 35>10 km 135

959 georeferenced · 238 without coordinates

Open the mapobservation + sensor1 197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 10≤1 km 9≤10 km 63

82 georeferenced · 525 without coordinates

Open the institutions mapphysical evidence607

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	226
University of Central Floridalocation not on record	171
Champaign, US	54
Cambridge, US	31
Mississippi State, US	30
Ciudad de México, MX	26
Tapachula, MX	17
University of Guelphlocation not on record	14
Riverside, US	6
San Diego, US	5
National Biodiversity Institute, Costa Ricalocation not on record	5
Los Angeles, US	4
Mexico City, MX	3
California Department of Food and Agriculture, California State Collection of Arthropodslocation not on record	3
Universidad Católica de Manizaleslocation not on record	3
CUlocation not on record	1
New Mexico Museum of Natural History and Sciencelocation not on record	1
Lubbock, US	1
San Francisco, US	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
Centro Nacional de Investigación Disciplinaria en Conservación y Mejoramiento de Ecosistemas Forestales, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record	1

21 institutions · 604 of 607 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Pangaeus bilineatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

Pine-oak scrubAgricultural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 16.6–25.7

Seasonal swing summer↔winter10.9 °C

Max temp (day)27.6 °C 21.9–31.2

Min temp (night)16.9 °C 12.4–20.4

Precipitation92.8 mm/mo 73.2–111

Air humidity56.9 % 53.4–58.4

Moisture balance-58.1 mm/mo -84.8–-20.6

Vapour deficit1,108 Pa 883–1,413

Wind speed2.60 m/s 2.20–3.30

Cloud cover32.6 % 29.0–40.2

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pangaeus bilineatus

At a glance

Sources7 archives

At a glance

Record type1 805 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 21 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 805 records