Pandorea floribunda

(A.Cunn. ex DC.) Guymer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Pandorea

At a glance

Occurrence records295

Data sources6

Biological traits16

DNA specimens3

eDNA detections1

Sources6 archives

Databases and archives Pandorea floribunda's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility295 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF295 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pandorea floribunda is a species of flowering plant in the family Bignoniaceae and is endemic to eastern Australia. It is similar to Pandorea pandorana but the leaflets are egg-shaped, long and wide and the flowers are pale yellow to cream-coloured. This species was first formally described in 1845 by Augustin Pyramus de Candolle who gave it the name Tecoma floribunda in his treatise, Prodromus Systematis Naturalis Regni Vegetabilis from an unpublished description by Allan Cunningham. In 2008, Gordon P. Guymer changed the name to Pandorea floribunda in the journal Austrobaileya. Pandorea floribunda grows in forest, woodland and rainforest from sea leavel to an altitude of on the coast and ranges from Gladstone in Queensland to Lismore in New South Wales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology4

Leaf length80 mm

Leaf width45 mm

Seed length10 mm

Seed width7 mm

Life cycle & reproduction3

Life formliana

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formclimber

Leaf compoundnesscompound

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pandorea floribunda has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895724.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAGGATACTGATATCTTGGCAGC …

Pandorea floribunda voucher 1076420414 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type295 records

Wild obs. + sensor137

Museum / vouchered147

Other11

Origin

Native25

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 37≤1 km 11>10 km 8

56 georeferenced · 81 without coordinates

Open the mapobservation + sensor137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 42≤1 km 7≤10 km 59>10 km 30

138 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence147

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	97
Mount Annan, AU	26
Museo Entomologico de Leonlocation not on record	17
Kew, GB	2
Armidale, AU	2
Adelaide, AU	2
Canberra, AU	1

7 institutions · 147 of 147 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Pandorea floribunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)