Pandorea doratoxylon

(J.M.Black) J.M.Black · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Pandorea

At a glance

Occurrence records1 002

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Pandorea doratoxylon's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 002 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF1 002 records

DNA & barcodingNCBIsequences

01Narrative

Pandorea doratoxylon is a species of woody vine in the family Bignoniaceae and is endemic to Australia. The species was first formally described in 1927 by John McConnell Black who gave it the name Tecoma doratoxylon in Transactions and Proceedings of the Royal Society of South Australia. In 1937, Black changed the name to Pandorea doratoxylon. Plants of the World Online gives the distribution of this species as "New South Wales, Queensland" and the Australian Plant Census as "WA, NT, Qld, NSW" but the name is "not current" in Western Australia and is listed as a synonym of Pandorea pandorana (Andrews) Steenis subsp. pandorana in New South Wales. Pandorea doratoxylon is an accepted species in the Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length45 mm

Leaf length27.5 mm

Leaf width5 mm

Plant height5 m

Seed mass7.55 mg

Seed mass max7.55 mg

Seed mass min7.55 mg

Life cycle & reproduction7

Dispersal typewind

Flowering timennnyyyynnnnn

Life formliana

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formclimber_woody shrub

⚠ sources differ — AusTraits: climber_woody shrub · TRY: climber

Leaf compoundnesscompound

Leaf shapeelliptical lanceolate linear

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pandorea doratoxylon has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSMW886222.1 ↗579 bp

ACGT

TCGTAACCTGCAAAGCAGACCGTGAACATGTTTTTAACACCGGGGGAATCGGCGTGGTGGGAGACCTCCCGCCGTGAACCCTTCCTGCTG …

Pandorea doratoxylon voucher C.R. Mitchell 879 (NY) internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type1 002 records

Wild obs. + sensor513

Museum / vouchered488

Cultivated / captive1

Origin

Native19

Range

Area of Occupancy AOO2 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 139≤1 km 29≤10 km 16>10 km 7

191 georeferenced · 322 without coordinates

Open the mapobservation + sensor513

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 49≤1 km 95≤10 km 265>10 km 41

450 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence488

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	125
Palmerston, AU	106
Canberra, AU	92
Museo Entomologico de Leonlocation not on record	79
Brisbane, AU	37
Kensington, AU	23
Armidale, AU	8
Hobart, AU	4
Mount Annan, AU	3
John T. Waterhouse Herbariumlocation not on record	3
Smithfield, AU	3
Kew, GB	1
Parkville, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
James Cook Townsvillelocation not on record	1
Saint Louis, US	1

16 institutions · 488 of 488 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pandorea doratoxylon

At a glance

Sources5 archives

Size & morphology7

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

At a glance

Record type1 002 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Record type1 002 records