Pandorea baileyana

(Maiden & R.Baker) Steenis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Pandorea

At a glance

Occurrence records137

Data sources7

Biological traits28

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Pandorea baileyana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pandorea baileyana, commonly known as large-leaved wonga vine, is a species of flowering plant in the family Bignoniaceae and is endemic to eastern Australia. It is a woody climber with pinnate leaves that have seven to nine egg-shaped leaflets, and relatively small cream-coloured flowers that are pink inside.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf length135 mm

Leaf length max300 mm

Leaf length min130 mm

Leaf width37.5 mm

Leaf width max55 mm

Leaf width min20 mm

Petiole length4.5 cm

Seed length7.5 mm

Seed width4.5 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering endMar

Flowering startSep

Flowering timeyyynnnnnyyyy

Life formliana

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formclimber

Leaf compoundnesscompound

Leaf shapeovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pandorea baileyana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895975.1 ↗553 bpAustralia

ACGT

AAGTGTGGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAGGATACTGATATCTGGGCAGC …

Pandorea baileyana voucher 129308723 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type137 records

Wild obs. + sensor83

Museum / vouchered47

Cultivated / captive1

Other6

Origin

Native11

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 39≤1 km 8≤10 km 2>10 km 1

50 georeferenced · 33 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 14≤1 km 4≤10 km 12>10 km 4

34 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence47

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	16
Mount Annan, AU	11
Armidale, AU	7
Canberra, AU	5
Museo Entomologico de Leonlocation not on record	3
Kew, GB	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Saint Louis, US	1

8 institutions · 46 of 47 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Pandorea baileyana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 19.3–19.3

Seasonal swing summer↔winter9.90 °C

Max temp (day)23.5 °C

Min temp (night)15.6 °C

Precipitation128 mm/mo

Air humidity61.9 %

Moisture balance15.0 mm/mo

Vapour deficit865 Pa

Wind speed1.40 m/s

Cloud cover24.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)