Pandanus utilis

Bory · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Pandanales/Pandanaceae/Pandanus

At a glance

Occurrence records1 903

Data sources12

Biological traits20

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Pandanus utilis's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 898 records↗

OBISOcean Biodiversity Information System5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF · OBIS1 903 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 60

01Narrative

Pandanus utilis, the common screwpine is, despite its name, a monocot and not a pine. It is native to Madagascar and naturalised in Mauritius and the Seychelles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height6 m

Seed volume4 600 mm³

Seed volume max4 600 mm³

Seed volume min4 600 mm³

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal type detailedanemochorous

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Succulenceno

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition3 compounds

Compounds documented for Pandanus utilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Furofuranoid lignans1

Cinnamic acids and derivatives1

Shikimic acids and derivatives $ Simple phenolic acids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
Coniferyl aldehyde	present	LOTUS
methyl 3-[(2S)-2,3-dihydroxy-3-methylbutyl]-4-hydroxybenzoate	present	LOTUS
Pinoresinol monomethyl ether	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pandanus utilis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences9

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKR529871.1 ↗632 bp

ACGT

AAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACT …

Pandanus utilis isolate G220 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pandanus utilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Ploidypolyploid inferred

Chromosome records16–802n range60median60mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Winkler, H. 1921 (Tischler, G.

2n 601×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Gunguly, B. 1959 ; Mallick, R. & Sharma, A.K. 1966

2n 801×CCDB · Cave1959

CCDB · Cave1959 — Gunguly 1959

n 301×CCDB · Cave1959

CCDB · Cave1959 — Gunguly 1959

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.705 ↗

08Occurrence & distribution

Record type1 903 records

Wild obs. + sensor1 841

Museum / vouchered59

Other3

Origin

Introduced96

Range

Area of Occupancy AOO1 608 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 122.5 m · max 140 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 769≤1 km 74≤10 km 547>10 km 268

1 658 georeferenced · 183 without coordinates

Open the mapobservation + sensor1 841

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 3≤10 km 4

12 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	4
Bronx, US	4
Saint Louis, US	4
Mérida, MX	3
Chongqing Museumlocation not on record	3
Auckland, NZ	2
Berlin, DE	2
North Carolina Zoological Parklocation not on record	2
Miami, US	2
Antiguo Cuscatlán, SV	2
Tampa, US	1
Philadelphia, US	1
MAlocation not on record	1
Campo Mourão, BR	1
Durban, ZA	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1
Pontifícia Universidade Católica do Paranálocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
UTFPR-CPlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Seychelles National Herbariumlocation not on record	1
EL PASO, US	1

23 institutions · 41 of 59 vouchered records shown · 12 without an institution code

09Environmental DNA2 detections

Where the DNA of Pandanus utilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 21.3–21.3

Seasonal swing summer↔winter5.60 °C

Max temp (day)23.5 °C

Min temp (night)19.5 °C

Precipitation159 mm/mo

Air humidity67.5 %

Moisture balance21.3 mm/mo

Vapour deficit819 Pa

Wind speed3.90 m/s

Cloud cover27.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pandanus utilis

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Compound class profile3 classes

Documented compounds3 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 903 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 903 records