Pandanus boninensis

Warb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Pandanales/Pandanaceae/Pandanus

At a glance

Occurrence records159

Data sources13

Biological traits11

DNA specimens6

eDNA detections2

Sources13 archives

Databases and archives Pandanus boninensis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility159 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF159 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 64

01Narrative

Pandanus boninensis is an Asian species of plant that is endemic to and common in the Distylium-Schima dry forests and Raphiolepis-Livistona dry forests of the Ogasawara Islands, Japan. It has aerial prop roots and grows on rocks. The beetle, Phylloplatypus pandani is a leaf miner that consumes the leaves of P. boninensis, it was first described by scientists in 1998. The fungus, Kodonospora tetracolumnaris was isolated from dead leaves of P. boninensis and described in 1993.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height8 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Pandanus boninensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Furofuranoid lignans8

Cycloartane triterpenoids4

Lanostane, Tirucallane and Euphane triterpenoids3

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Kobusin	present	LOTUS
(1S,3R,6S,8R,11S,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-4-[(1S)-1,2,2-trimethylcyclopropyl]butan-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	LOTUS
(3R,3aS,6R,6aS)-3,6-bis(3,4-dimethoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan	present	LOTUS
(3S,5R,8S,10S,13R,14S,17R)-4,4,10,13,14-pentamethyl-17-[(2R)-4-[(1S)-1,2,2-trimethylcyclopropyl]butan-2-yl]-2,3,5,6,7,8,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
24,24-Dimethyllanosta-9(11),25-dien-3beta-ol	present	LOTUS
24-Methylenecycloartan-3-ol	present	LOTUS
4-[(3R,3aR,6S,6aS)-6-(4-hydroxy-3-methoxyphenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-3-yl]-2-methoxyphenol	present	LOTUS
Sesamin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pandanus boninensis has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC694656.1 ↗599 bpJapan · 2010

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGC …

Pandanus boninensis TF<JPN>:oOGA0078 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK8★rbcL2trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Pandanus boninensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 641×CCDB · book-fedorov

CCDB · book-fedorov — Harada 1949a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.705 ↗

08Occurrence & distribution

Record type159 records

Wild obs. + sensor56

Museum / vouchered103

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 8≤1 km 4>10 km 43

55 georeferenced · 1 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 103 records without

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	17
Berlin, DE	4
Forestry and Forest Products Research Institutelocation not on record	2
Museo Athanasius Kircher di Romalocation not on record	1
Sanda, JP	1
South Kensington, GB	1

6 institutions · 26 of 103 vouchered records shown · 77 without an institution code

09Environmental DNA2 detections

Where the DNA of Pandanus boninensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 18.7–24.5

Seasonal swing summer↔winter9.20 °C

Max temp (day)22.4 °C 19.7–25.1

Min temp (night)20.8 °C 17.7–23.9

Precipitation98.8 mm/mo 65.1–132

Air humidity62.4 % 56.4–68.4

Vapour deficit946 Pa 929–963

Cloud cover53.4 % 46.0–60.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)