Pandanus amaryllifolius

Roxb. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Pandanales/Pandanaceae/Pandanus

At a glance

Occurrence records159

Data sources10

Biological traits17

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Pandanus amaryllifolius's data was compiled from.

GBIFGlobal Biodiversity Information Facility159 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources17 traits

Chemical compositionNPASS5 compounds

Occurrence & distributionGBIF159 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI≈492 Mbp

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Leaf length300 mm

Leaf width15 mm

Plant height3 m

Life cycle & reproduction5

Deciduousnessevergreen

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Pandanus amaryllifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile2 classes

Bauerane triterpenoids1

Flavones1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
Bauerenyl acetate	present	NPASS
Epi-Pandamarilactonine-H	present	NPASS
Eupatilin	present	NPASS
Methyl 2-[(2R)-1-[(4Z)-4-(4-Methyl-5-Oxofuran-2-Ylidene)Butyl]Pyrrolidin-2-Yl]Acetate	present	NPASS
Pandamarilactonine-H	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pandanus amaryllifolius has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLPX511747.1 ↗623 bpIndia

ACGT

AAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTC …

Pandanus amaryllifolius ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7

plant barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Pandanus amaryllifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈491 645 732 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pandanus amaryllifolius0.49 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Ploidypolyploid inferred

Chromosome records60–702n range65median70mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 601×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — CHEAH, C.H., & B.C. STONE. 1973. Chromosome numbers in the genus Pandanus (Pandanaceae). Bot. Jahrb. 93: 498-529.

2n 701×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Mohan, N. M. & D. Subramanian. 1990. Cytotaxomical and biochemical studies in south Indian Pandanaceae. Proc. Indian Sci. Congr. Assoc. 77(3,VI): 149.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.705 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type159 records

Wild obs. + sensor46

Museum / vouchered111

Cultivated / captive2

Origin

Introduced2

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 25≤1 km 6>10 km 4

35 georeferenced · 11 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 1≤10 km 3

5 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence111

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	2
Guangzhou, CN	2
Xiamen, CN	1
BISHlocation not on record	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1

5 institutions · 7 of 111 vouchered records shown · 101 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Pandanus amaryllifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 26.1–27.0

Seasonal swing summer↔winter1.80 °C

Max temp (day)28.1 °C 28.1–29.9

Min temp (night)25.7 °C 22.7–25.7

Precipitation198 mm/mo 198–287

Air humidity64.5 % 64.5–67.9

Moisture balance39.1 mm/mo 39.1–137

Vapour deficit1,263 Pa 1,087–1,263

Wind speed2.90 m/s 1.10–2.90

Cloud cover50.4 % 50.0–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)