Pandalus borealis

Krøyer, 1838 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Pandalidae/Pandalus

At a glance

Occurrence records38 541

Data sources13

Biological traits6

DNA specimens94

eDNA detections114

Sources13 archives

Databases and archives Pandalus borealis's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 833 records↗

OBISOcean Biodiversity Information System20 708 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI114 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics94 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS58 compounds

Occurrence & distributionGBIF · OBIS38 541 records

Environmental DNA3 datasets · 10 countries114 detections

DNA & barcodingBOLD94 specimens

Genome at a glanceGoaT · NCBI≈3.5 Gbp

01Narrative

Pandalus borealis is a species of caridean shrimp found in cold parts of the northern Atlantic and northern Pacific Oceans, although the latter population now often is regarded as a separate species, P. eous. The Food and Agriculture Organization refers to them as the northern prawn. Other common names include pink shrimp, deepwater prawn, deep-sea prawn, Nordic shrimp, great northern prawn, northern shrimp, coldwater prawn and Maine shrimp.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length12 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max1 450 m

Depth min9 m

03Chemical composition58 compounds

Compounds documented for Pandalus borealis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Spirostane steroids32

Apocarotenoids (β-) $ Cyclophytane diterpenoids5

Oligomeric stibenes3

Imidazole alkaloids2

Furostane steroids1

Documented compounds58 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Hecogenin	present	NPASS
(1R,2R,4R,5'R,6R,7S,8R,9S,12S,13S,16S,18S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-ol	present	NPASS
(1R,2R,4S,5'R,6R,7S,8S,9S,12S,13S,16S,18R)-16-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3,4-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-10-one	present	NPASS
(1R,2R,4S,5'R,6R,7S,8S,9S,12S,13S,16S,18R)-16-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-3,4-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-10-one	present	NPASS
(1R,2R,4S,5'S,6R,7R,8S,9S,12R,13S,16S,18R)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-ol	present	NPASS
(1R,2S,3'S,4R,5'S,6S,8S,9S,12R,13S,16S,18S)-3',5',9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-ol	present	NPASS
(1R,2S,4R,5'R,6R,7S,8R,9S,12R,13S,15R,16R,18S)-16-[(2R,3R,4R,5R,6R)-5-[(2S,3R,4S,5R,6R)-4-[(2S,3R,4R,5R)-3,4-dihydroxy-5-[(2S,3R,4R,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-15-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-10-one	present	NPASS
(1R,2S,4S,5'R,6R,7S,8R,9S,12S,13S,15R,16R,18S)-15,16-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-10-one	present	NPASS
(1R,2S,4S,5'R,6R,7S,8R,9S,12S,13S,16S,18R)-16-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3,4-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-10-one	present	NPASS
(1R,2S,4S,5'R,6R,7S,8R,9S,12S,13S,16S,18R)-16-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-3,4-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-10-one	present	NPASS

05DNA & barcoding94 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pandalus borealis has left across the world's sequence archives.

At a glance

DNA specimens94

BINs1

Marker genes1

eDNA detections114

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus91 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

50Tmostly conserved

112Tmostly conserved

193Cmostly conserved

319Gmostly conserved

382Cmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAGCTTGGTCTGGGATAGTGGGAACTTCCTTAAGACTTTTAATTCGAGCTGAGTTAGGTCAACCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes8

BIN1

Most divergent pair1.2%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pandalus jordanisame genus6.8%Pandalus montaguisame genus11.2%Pandalus goniurussame genus12.5%Pandalus hypsinotussame genus14.0%Pandalus danaesame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pandalus borealis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈3 509 034 484 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Pandalus borealis3.51 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type38 541 records

Wild obs. + sensor34 861

Museum / vouchered3 048

Other632

Range

Area of Occupancy AOO55 380 km²

Depth

0–200 m sunlit8 993

200–1000 m twilight9 387

1–4 km midnight10

>4 km abyssal0

median 203.7 m · max 1 319 m · 18 390 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 10 518≤1 km 4 362≤10 km 31>10 km 32

14 943 georeferenced · 19 918 without coordinates

Open the mapobservation + sensor34 861

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 40≤1 km 76≤10 km 75>10 km 50

241 georeferenced · 2 807 without coordinates

Open the institutions mapphysical evidence3 048

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	840
Norwegian Institute of Marine Researchlocation not on record	179
Frankfurt am Main	153
Tromsø, NO	144
Washington, US	133
ICESlocation not on record	116
Bergen, NO	96
Gothenburg, SE	86
SLU Artdatabankenlocation not on record	64
The Atlantic reference Centrelocation not on record	61
Cambridge, US	49
Victoria, CA	35
NTNU-VMlocation not on record	33
CASlocation not on record	32
	30
Edmonton, CA	28
730location not on record	22
University of Oslo (UiO)location not on record	21
Maurice Lamontagne Institutelocation not on record	20
Toronto, CA	13
South Kensington, GB	12
Bergen, NO	11
Zoologisches Museum Hamburglocation not on record	9
ArCODlocation not on record	8
Helsinki, FI	7
New Haven, US	7
Brussels, BE	7
Instytut Oceanologii Polskiej Akademii Nauklocation not on record	6
Museum für Naturkunde Berlin (Zoological Collections)location not on record	5
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	5
Saint John, CA	4
RBINS-Scientific Heritagelocation not on record	3
The Atlantic Reference Centre (ARC)location not on record	2
ArcODlocation not on record	2
Stockholm, SE	1
National Marine Biodiversity Institute of Korealocation not on record	1
Santa Barbara Museum of Natural Historylocation not on record	1
MZLUlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
BioFokuslocation not on record	1
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	1
Goteborg Natural History Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1
Deutsches Zentrum fuer Marine Biodiversitaetsforschunglocation not on record	1
Assiniboine Park Conservancylocation not on record	1
The Manitoba Museumlocation not on record	1

46 institutions · 2 255 of 3 048 vouchered records shown · 30 without an institution code

09Environmental DNA114 detections

Where the DNA of Pandalus borealis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found114

Studies independent surveys3

Countries10

Verifiable raw sequence linked11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 114 detections have coordinates

Open the map10 countries0

Soft bottom,MarineBaffin BayDavis StraitGulf of St. Lawrence

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.10 °C -8.20–15.9

Seasonal swing summer↔winter18.0 °C

Max temp (day)8.90 °C -5.80–18.6

Min temp (night)5.80 °C -11.3–13.6

Precipitation62.4 mm/mo 37.4–115

Air humidity62.7 % 59.4–70.7

Vapour deficit384 Pa 132–740

Cloud cover53.1 % 39.5–66.5

CHELSA 1981–2010, ~9 km grid, at location & month of 80 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pandalus borealis

At a glance

Sources13 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits2

Compound class profile5 classes

Documented compounds58 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type38 541 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type38 541 records