Panda oleosa

Pierre · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Pandaceae/Panda

At a glance

Occurrence records854

Data sources12

Biological traits29

DNA specimens14

eDNA detections8

Sources12 archives

Databases and archives Panda oleosa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility854 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Chemical compositionLOTUS · NPASS16 compounds

Occurrence & distributionGBIF854 records

Environmental DNA1 datasets · 4 countries8 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Panda is a plant genus of the family Pandaceae. It contains only one known species, Panda oleosa, native to western and central Africa (Liberia, Ghana, Guinea, Ivory Coast, Nigeria, Cabinda, Gabon, Central African Republic, Congo-Brazzaville, Cameroon, Zaire).Kew World Checklist of Selected Plant FamiliesHarris, D.J. (2002). The vascular plants of the Dzanga-Sangha Reserve, Central African Republic: 1-274. National Botanic Garden (Belgium), Meise.Sita, P. & Moutsambote, J.-M. (2005). Catalogue des plantes vasculaires du Congo , ed. sept. 2005: 1-158. ORSTOM, Centre de Brazzaville.Sosef, M.S.M. & al. (2006). Check-list des plantes vasculaires du Gabon. Scripta Botanica Belgica 35: 1-438.Figueiredo, E. & Smith, G.F. (2008). Plants of Angola. Strelitzia 22: 1-279. National Botanical Institute, Pretoria.Lisowski, S. (2009). Flore (Angiospermes) de la République de Guinée. Scripta Botanica Belgica 41: 1-517.Lejoy, J., Ndjele, M.-B. & Geerinck, D. (2010). Catalogue-flore des plantes vasculaires des districts de Kisangani et de la Tshopo (RD Congo). Taxonomania. Revue de Taxonomie et de Nomenclature Botaniques 30: 1-307. Chimpanzees have been observed to hammer on the nuts of Panda oleosa, which are particularly hard to open.Chimp Nut-Cracking Site Offers Clues to Early Tool Use. By Bijal P. Trivedi, National Geographic Today. May 23, 2002 Humans cook and eat the seeds and also use an oil produced by the seeds in food preparation, the wood is used to make canoes and for carpentry.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height20 m

⚠ sources differ — GIFT: 20 m · TRY: 15.95 m

Plant height max18.29 m

Seed volume35 000 mm³

Seed volume max35 000 mm³

Seed volume min35 000 mm³

Life cycle & reproduction7

Deciduousnessevergreen

Flowering endFeb

Flowering startFeb

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Mycorrhiza type1.5E-17

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio15.54 g/g

Leaf c463 mg/g

Leaf dry-matter content (LDMC)337 mg/g

Leaf n29.43 mg/g

Leaf p2.32 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density586 mg/cm³

03Chemical composition16 compounds

Compounds documented for Panda oleosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile4 classes

Flavonols10

Flavan-3-ols2

Flavones2

Eudesmane sesquiterpenoids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
3,3'-di-O-methylquercetin	present	NPASS
3,4',5,6,7-Pentamethoxyflavone	present	NPASS
3-Methoxytangeretin	present	NPASS
3-O-Methylkaempferol	present	NPASS
4'-Hydroxytetramethoxyflavone	present	NPASS
4'-O-Methyl-Gallocatechin	present	LOTUS
6-Hydroxykaempferol 3,6-dimethylether	present	NPASS
Apigenin	present	NPASS
Chrysoeriol	present	NPASS
CID 15281605	present	LOTUS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Panda oleosa has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences2

eDNA detections8

Countries4

The DNA barcodea real sequence read deposited for this species

rbcLAY663644.1 ↗1 410 bp

ACGT

GTTGGATTCAAGGCTGGTGTTAAAGAATATAAATTGACTTATTATACTCCTGACTATCAAACCAAAGATACTGATATCTTAGCAGCATTC …

Panda oleosa ribulose 1,5-bisphosphate carboxylase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

07Deep time~0 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type854 records

Wild obs. + sensor168

Museum / vouchered686

Range

Area of Occupancy AOO1 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 8

12 georeferenced · 156 without coordinates

Open the mapobservation + sensor168

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 1≤1 km 2≤10 km 4>10 km 3

10 georeferenced · 676 without coordinates

Open the institutions mapphysical evidence686

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	98
LBVlocation not on record	95
BRLUlocation not on record	87
Saint Louis, US	54
Yaoundé, CM	32
WAGlocation not on record	28
Herbier National du Gabonlocation not on record	20
Kew, GB	16
Adam Mickiewicz University in Poznańlocation not on record	14
Forest Herbarium Ibadan (FHI)location not on record	14
University of Santo Tomas Museumlocation not on record	12
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	11
Plocation not on record	10
Bronx, US	6
CNF-UFHBlocation not on record	5
CJBGlocation not on record	3
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	3
Chongqing Museumlocation not on record	3
Edinburgh, GB	2
IPHAMETRAlocation not on record	2
Elocation not on record	2
Glocation not on record	2
National Natural History Collectionslocation not on record	2
Universite Libre de Bruxelles, Herbariumlocation not on record	2
National Botanical Gardens of Belgiumlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Claremont, US	1
MAlocation not on record	1
Frankfurt am Main	1
Clocation not on record	1
University of Stellenboschlocation not on record	1
EAlocation not on record	1
University of Oxfordlocation not on record	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
IFANlocation not on record	1
Pretoria, ZA	1
Université du Lomélocation not on record	1
Daubeny Herbarium, Oxfordlocation not on record	1
Beijing, CN	1
Uppsala, SE	1
Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record	1

41 institutions · 542 of 686 vouchered records shown · 144 without an institution code

09Environmental DNA8 detections

Where the DNA of Panda oleosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 22.6–26.9

Seasonal swing summer↔winter2.40 °C

Max temp (day)29.0 °C 26.9–30.4

Min temp (night)21.0 °C 19.6–23.9

Precipitation143 mm/mo 48.5–252

Air humidity69.1 % 66.8–73.4

Moisture balance4.40 mm/mo -83.0–128

Vapour deficit967 Pa 729–1,145

Wind speed1.60 m/s 1.30–2.50

Cloud cover32.0 % 16.5–56.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)