Palthis angulalis

Hübner, 1796 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Palthis

At a glance

Occurrence records11 468

Data sources7

Biological traits0

DNA specimens140

eDNA detections143

Sources7 archives

Databases and archives Palthis angulalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 468 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI143 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics140 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF11 468 records

Environmental DNA1 datasets · 2 countries143 detections

DNA & barcodingBOLD140 specimens

01Narrative

Palthis angulalis, the dark-spotted palthis, is a moth of the family Erebidae. The species was first described by Jacob Hübner in 1796. It is found from Newfoundland west to coastal British Columbia, south to Florida and Texas. The wingspan is 20–26 mm. Adults are on wing from May to August in Alberta. There are two generations in much of the eastern part of its range, three or more generations from Missouri southward. The larvae feed on various plants, including forbs, woody shrubs and trees (alder, aster, basswood, birch, chestnut, fir, sweetgale, goldenrod, ninebark, rhododendron, scrub oak and spruce).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding140 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palthis angulalis has left across the world's sequence archives.

At a glance

DNA specimens140

BINs1

Marker genes1

eDNA detections143

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus137 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

28Amostly conserved

466Gmostly conserved

553Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCCCTAAGATTATTAATTCGAGCTGAATTAGGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes17

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Strathocles imitatasame family5.9%Palthis bizialissame genus5.9%Palthis angustipennissame genus6.1%Lascoria niveasame family6.2%Scotogramma ptilodontasame order6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type11 468 records

Wild obs. + sensor10 691

Museum / vouchered777

Range

Area of Occupancy AOO19 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5 894≤1 km 1 624≤10 km 450>10 km 1 036

9 004 georeferenced · 1 687 without coordinates

Open the mapobservation + sensor10 691

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 10≤1 km 44≤10 km 209>10 km 28

291 georeferenced · 486 without coordinates

Open the institutions mapphysical evidence777

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	125
University of Alberta Museums (UAM)location not on record	113
Mississippi State, US	86
Cambridge, US	59
St. Paul, US	45
Cleveland Museum of Natural History, OH (CLEV)location not on record	35
University of Guelph, Centre for Biodiversity Genomicslocation not on record	28
East Lansing, US	28
Cornell University Insect Collectionlocation not on record	23
CUlocation not on record	20
Royal Saskatchewan Museumlocation not on record	11
Georgia Museum of Natural Historylocation not on record	9
University of Alabamalocation not on record	9
King Saud Universitylocation not on record	9
Colorado State Universitylocation not on record	7
Philadelphia, US	6
OSUClocation not on record	4
Toronto, CA	4
University of Guelphlocation not on record	3
Decorah, US	3
SOVTlocation not on record	3
Washington, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Natural History Museum of Utahlocation not on record	2
University of California, Davislocation not on record	2
Saint John, CA	2
Biodiversity Institute of Ontariolocation not on record	2
ASUlocation not on record	2
KWPlocation not on record	1
University Park, US	1
UDlocation not on record	1
Vernal, US	1
Chicago, US	1
Denver, US	1
Oregon State Arthropod Collectionlocation not on record	1
Champaign, US	1

36 institutions · 652 of 777 vouchered records shown · 125 without an institution code

09Environmental DNA143 detections

Where the DNA of Palthis angulalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found143

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 143 detections have coordinates

Open the map2 countries0

Grassland1. Forest & Woodland|1.1 Boreal ForestMixed habitatWetlandForestBeach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 12.6–22.5

Seasonal swing summer↔winter26.1 °C

Max temp (day)22.8 °C 16.7–27.1

Min temp (night)13.2 °C 8.00–18.4

Precipitation94.9 mm/mo 74.1–132

Air humidity58.7 % 55.1–63.0

Moisture balance-41.6 mm/mo -85.2–12.0

Vapour deficit807 Pa 585–1,096

Wind speed3.20 m/s 1.70–4.40

Cloud cover40.0 % 32.8–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 141 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Palthis angulalis

At a glance

Sources7 archives

At a glance

Record type11 468 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 468 records