Palmophyllum umbracola

W.A.Nelson & K.G.Ryan · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Palmophyllophyceae/Palmophyllales/Palmophyllaceae/Palmophyllum

At a glance

Occurrence records57

Data sources5

Biological traits4

DNA specimens2

eDNA detections2

Sources5 archives

Databases and archives Palmophyllum umbracola's data was compiled from.

GBIFGlobal Biodiversity Information Facility46 records↗

OBISOcean Biodiversity Information System11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS57 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max22 m

Depth min2 m

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palmophyllum umbracola has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLEU586182.1 ↗1 268 bpNew Zealand

ACGT

CATACTATACTCCAGATTATGTTGTTCTACCAACGGATGTTTTAGCAGCATTCCGTGTAACACCTCAACCAGGTGTTCCTGCAGAAGAAG …

Palmophyllum umbracola voucher WELT:A26526 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor16

Museum / vouchered39

Other2

Origin

Native1

Range

Area of Occupancy AOO140 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 82 m · max 106 m · 9 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 6

14 georeferenced · 2 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 4≤10 km 10

15 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	14
Museo Entomologico de Leonlocation not on record	8
Adelaide, AU	4
Kensington, AU	2
Mount Annan, AU	1
Christchurch, NZ	1

6 institutions · 30 of 39 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Palmophyllum umbracola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 6.40–11.8

Seasonal swing summer↔winter19.7 °C

Max temp (day)13.8 °C 10.1–17.5

Min temp (night)4.80 °C 2.10–7.60

Precipitation105 mm/mo 84.7–125

Air humidity60.0 % 57.9–62.1

Moisture balance8.00 mm/mo -29.1–45.1

Vapour deficit545 Pa 395–695

Wind speed5.90 m/s 5.80–5.90

Cloud cover37.8 % 36.9–38.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)