Palmophyllum crassum

Plantae/Chlorophyta/Palmophyllophyceae/Palmophyllales/Palmophyllaceae/Palmophyllum

At a glance

Occurrence records2 376

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Palmophyllum crassum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 139 records↗

OBISOcean Biodiversity Information System237 records↗

NCBIUS National Library of Medicinesequences↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS2 376 records

DNA & barcodingNCBIsequences

01Narrative

Palmophyllum crassum is a species of alga.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palmophyllum crassum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMF769370.1 ↗1 267 bpJapan

ACGT

CATACTATACTCCAGATTATGTTGTTGAACCAACTGATGTTTTAGCAGCATTCCGTGTAACACCTCAACCAGGTGTTCCTGCAGAAGAAG …

Palmophyllum crassum voucher MSK170417-03 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL8

plant barcode

08Occurrence & distribution

Record type2 376 records

Wild obs. + sensor2 068

Museum / vouchered145

Other163

Origin

Native3

Range

Area of Occupancy AOO1 732 km²

Depth

0–200 m sunlit138

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 57.5 m · max 125 m · 138 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 240≤1 km 113≤10 km 24

377 georeferenced · 1 691 without coordinates

Open the mapobservation + sensor2 068

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 32≤1 km 4≤10 km 12>10 km 2

50 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	14
Brisbane, AU	13
BISHlocation not on record	9
University of Stellenboschlocation not on record	5
LDlocation not on record	3
PSVlocation not on record	3
Adelaide, AU	3
Paris, FR	2
Universidad de Málagalocation not on record	1
GRAlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Barcelona, ES	1
Ann Arbor, US	1
Mount Annan, AU	1
Auckland, NZ	1
National Marine Biodiversity Institute of Korealocation not on record	1
South Kensington, GB	1
San Diego, US	1

18 institutions · 62 of 145 vouchered records shown · 12 without an institution code

At a glance

Sources5 archives

At a glance

Record type2 376 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 18 geolocated

Record type2 376 records