Pallenis hierochuntica

(Michon) Greuter · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pallenis

At a glance

Occurrence records285

Data sources8

Biological traits35

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Pallenis hierochuntica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility285 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources35 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF285 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 10

01Narrative

Pallenis hierochuntica (common names include rose of Jerichopages 2920-2921 and dinosaur plant) is a species of Pallenis that is notable for being a resurrection plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology6

Fruit length max2.5 mm

Fruit length min2 mm

Plant height0.019 m

Seed mass0.087 mg

⚠ sources differ — TRY: 0.087 mg · GIFT: 317 mg

Seed mass max317 mg

Seed mass min317 mg

Life cycle & reproduction12

Dehiscenceindehiscent

Dispersal typewind

Flower colouryellow

Flower length max3.5 mm

Flower length min2 mm

Flower width max50 mm

Flower width min15 mm

Flowering endMar

Flowering startFeb

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max600 m

Elevation min0 m

Fruit typeachene

Growth formherb

Leaf formnarrow-elliptic

Woodinessnon-woody

Physiology & chemistry5

Leaf c434 mg/g

Leaf dry-matter content (LDMC)140 mg/g

Leaf n34.63 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)20.46 mm²/mg

Other traits2

Leaf arrangementalternate

Shoot length max7 cm

03Chemical composition13 compounds

Compounds documented for Pallenis hierochuntica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavones5

Acyclic monoterpenoids1

Flavonols1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
10-Isobutyryloxy-8,9-epoxythymol isobutyrate	present	LOTUS
[3-(2-Methylpropanoyloxy)-4-[2-(2-methylpropanoyloxymethyl)oxiran-2-yl]phenyl]methyl 2-methylpropanoate	present	LOTUS
[3-(2-Methylpropanoyloxy)-4-[2-(2-methylpropanoyloxymethyl)oxiran-2-yl]phenyl]methyl 3-methylbutanoate	present	LOTUS
Apigenin	present	LOTUS
Apiumetrin	present	LOTUS
Chrysoeriol	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Luteolin 7-glucoside	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pallenis hierochuntica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX282000.1 ↗433 bpKuwait

ACGT

GTGAACCATCGAGTTTTTGAACGCNAGTTGCGCCCAAAGCCACTTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTTCGCTCCT …

Pallenis hierochuntica voucher EDNA15-0043034 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pallenis hierochuntica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome records10–122n range10median10mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 102×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Wiklund, A. 1985. The genus Asteriscus (Asteraceae-Inuleae). Nordic J. Bot. 5: 299–314.

CCDB · book-ipcn75-78 — Humphries 1978

2n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Malallah, G. A., M. Masood & M. Al-Dosari. 2001. Chromosome numbers of the Kuwaiti flora, III. Willdenowia 31: 411–418.

n 62×CCDB · ipcn-api-dl · CCDB · Cave1957

CCDB · ipcn-api-dl — Malallah, G. A., M. Masood & M. Al-Dosari. 2001. Chromosome numbers of the Kuwaiti flora, III. Willdenowia 31: 411–418.

CCDB · Cave1957 — Reese

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type285 records

Wild obs. + sensor268

Museum / vouchered17

Range

Area of Occupancy AOO752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 89≤1 km 40≤10 km 27>10 km 16

172 georeferenced · 96 without coordinates

Open the mapobservation + sensor268

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	3
Edinburgh, GB	3
Bronx, US	2
València, ES	2
Kew, GB	1
Salamanca, ES	1
Stockholm, SE	1
Sevilla, ES	1
Frankfurt am Main	1
CICYTEXlocation not on record	1

10 institutions · 16 of 17 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)