Palisota bracteosa

C.B.Clarke · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Palisota

At a glance

Occurrence records363

Data sources8

Biological traits10

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Palisota bracteosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility363 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF363 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 80

01Narrative

Palisota bracteosa là một loài thực vật có hoa trong họ Commelinaceae. Loài này được C.B.Clarke mô tả khoa học đầu tiên năm 1881.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palisota bracteosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR246965.1 ↗332 bpNetherlands

ACGT

TAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGCACCCGAGAGCGGACGACCGCGAACCGTCGAAAC …

Palisota bracteosa isolate JFP077 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Palisota bracteosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Ploidypolyploid inferred

Chromosome records40–802n range80median80mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 803×CCDB · book-ipcn72 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn72 — JONES, K., & c. JOPLING. 1972. Chromosomes and the classification of the Commelinaceae. Bot. J. Linn. Soc. 65: 129-162.

CCDB · book-fedorov — Anderson E., Sax 1936

CCDB · book-atlas-flowering-plants — Anderson & S. 1936

2n 402×CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · book-ipcn67-71 — MORTON, J. K. 1967. The Commelinaceae of West Africa: a biosystematic survey. Jour. Linn. soc. Bot. 60: 167-221.

CCDB · book-fedorov — Morton J. K. 1967

n 361×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HEITZ, B. 1968. Commelinacees II. Inf. Ann. Caryosyst. et Cytogenet. 2: 26-32.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type363 records

Wild obs. + sensor132

Museum / vouchered231

Origin

Introduced12

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 62≤1 km 31≤10 km 5>10 km 5

103 georeferenced · 29 without coordinates

Open the mapobservation + sensor132

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 7

7 georeferenced · 224 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yaoundé, CM	32
Saint Louis, US	28
University of Stellenboschlocation not on record	20
Kew, GB	19
BRLUlocation not on record	12
Plocation not on record	10
MeiseBGlocation not on record	8
Brussels, BE	8
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	5
WAGlocation not on record	4
LBVlocation not on record	4
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	3
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	3
Paris, FR	2
CNF-UFHBlocation not on record	2
Herbier National du Gabonlocation not on record	2
Honolulu, US	2
BISHlocation not on record	2
IPHAMETRAlocation not on record	1
AMDlocation not on record	1
Université du Lomélocation not on record	1
St. Augustine, TT	1
South Kensington, GB	1

23 institutions · 171 of 231 vouchered records shown · 60 without an institution code

09Environmental DNA1 detections

Where the DNA of Palisota bracteosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)