Palisota barteri

Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Commelinales/Commelinaceae/Palisota

At a glance

Occurrence records612

Data sources11

Biological traits11

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Palisota barteri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility612 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS83 compounds

Occurrence & distributionGBIF612 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Palisota barteri is a species of plant in the Commelinaceae family, described in 1862. It is native to western + central Africa.Kew World Checklist of Selected Plant FamiliesBrunel, J.F., Hiepo, P. & Scholz, H. (eds.) (1984). Flore Analytique du Togo Phanérogames: 1-751. GTZ, Eschborn.Sita, P. & Moutsambote, J.-M. (2005). Catalogue des plantes vasculaires du Congo , ed. sept. 2005: 1-158. ORSTOM, Centre de Brazzaville.Sosef, M.S.M. & al. (2006). Check-list des plantes vasculaires du Gabon. Scripta Botanica Belgica 35: 1-438.Lisowski, S. (2009). Flore (Angiospermes) de la République de Guinée. Scripta Botanica Belgica 41: 1-517.Cabezas, F.J., de la Estrella, M., Aedo, C. & Velayos, M. (2009). Checklist of Commelinaceae of Equatorial Guinea (Annobón, Bioko and Río Mundi). Botanical Journal of the Linnean Society 159: 106-122.Lejoy, J., Ndjele, M.-B. & Geerinck, D. (2010). Catalogue-flore des plantes vasculaires des districts de Kisangani et de la Tshopo (RD Congo). Taxonomania. Revue de Taxonomie et de Nomenclature Botaniques 30: 1-307.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass9.37 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition83 compounds

Compounds documented for Palisota barteri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Piperidine alkaloids25

N-acyl amines8

Cinnamic acids and derivatives3

Apocarotenoids (β-)3

Bisabolane sesquiterpenoids3

Documented compounds83 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,5R,6S)-2,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-5-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide	present	NPASS
(1S,2R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-3-ene-1,2-diol	present	NPASS
(1S,2S,5R,6R)-5,6-bis(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)-2-(piperidine-1-carbonyl)cyclohex-3-ene-1-carboxamide	present	NPASS
(1S,4R,5R)-2-methyl-5-[(2S)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol	present	NPASS
(1S,4R,5R,6S)-N-(2-methylpropyl)-6-[(E)-3-(2-methylpropylamino)-3-oxoprop-1-enyl]-4,5-dipentylcyclohex-2-ene-1-carboxamide	present	NPASS
(2E,12E)-13-(1,3-benzodioxol-5-yl)-N-(2-methylpropyl)trideca-2,12-dienamide	present	NPASS
(2E,4E)-5-(1,3-benzodioxol-5-yl)-N-(3-methylbutyl)penta-2,4-dienamide	present	NPASS
(2E,4E)-5-(1,3-benzodioxol-5-yl)-N-[(2R)-2-methylbutyl]penta-2,4-dienamide	present	NPASS
(2E,4E)-5-(2H-1,3-benzodioxol-5-yl)-N-[(5E)-10-methylundec-5-en-1-yl]penta-2,4-dienamide	present	NPASS
(2E,4E,12Z)-N-(2-Methylpropyl)-2,4,12-octadecatrienamide	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palisota barteri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOL537028.1 ↗553 bpUSA · 2018

ACGT

TTTTGTTGGATTCAAAGCAGGTGTTAGAGATTATAAATTGACTTATTATACTCCTGATTACAAAACCAAAGATACTGATATATTGGCAGC …

Palisota barteri voucher MO:Carlsen3132 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Palisota barteri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · ipcn-api-dl — Faden, R. B. & Y. Suda. 1980. Cytotaxonomy of Commelinaceae: chromosome counts of some African and Asiatic species. Bot. J. Linn. Soc. 81: 301–325.

CCDB · book-ipcn67-71 — MORTON, J. K. 1967. The Commelinaceae of West Africa: a biosystematic survey. Jour. Linn. soc. Bot. 60: 167-221.

CCDB · book-fedorov — Morton J. K. 1967

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type612 records

Wild obs. + sensor164

Museum / vouchered445

Cultivated / captive3

Origin

Introduced37

Range

Area of Occupancy AOO884 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 6≤1 km 38≤10 km 2

46 georeferenced · 118 without coordinates

Open the mapobservation + sensor164

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤1 km 6≤10 km 6>10 km 5

17 georeferenced · 428 without coordinates

Open the institutions mapphysical evidence445

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	64
Saint Louis, US	50
MeiseBGlocation not on record	44
Kew, GB	36
Yaoundé, CM	35
MAlocation not on record	20
WAGlocation not on record	16
Plocation not on record	11
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	9
Brussels, BE	8
Adam Mickiewicz University in Poznańlocation not on record	7
BRLUlocation not on record	7
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	7
Paris, FR	5
IPHAMETRAlocation not on record	4
CJBGlocation not on record	4
LBVlocation not on record	4
Chongqing Museumlocation not on record	4
South Kensington, GB	4
Université du Lomélocation not on record	4
Herbier National du Gabonlocation not on record	3
Bronx, US	3
JBRJlocation not on record	2
Institute for Agricultural Research of Mozambiquelocation not on record	2
Frankfurt am Main	2
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	2
Tampa, US	1
CNF-UFHBlocation not on record	1
Clocation not on record	1
Auckland, NZ	1
LDlocation not on record	1
Njala Universitylocation not on record	1
Université Nangui Abrogoualocation not on record	1
Elocation not on record	1
Pretoria, ZA	1

35 institutions · 366 of 445 vouchered records shown · 79 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Palisota barteri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.5 °C

Min temp (night)8.70 °C

Precipitation114 mm/mo

Air humidity54.5 %

Moisture balance0.9 mm/mo

Vapour deficit709 Pa

Wind speed4.00 m/s

Cloud cover44.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)