Palicourea bracteocardia

(DC.) Delprete & J.H.Kirkbr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Palicourea

At a glance

Occurrence records307

Data sources6

Biological traits13

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Palicourea bracteocardia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility307 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF307 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Psychotria bracteocardia adalah spesies tumbuhan yang tergolong ke dalam famili Rubiaceae. Spesies ini juga merupakan bagian dari ordo Gentianales. Spesies Psychotria bracteocardia sendiri merupakan bagian dari genus Psychotria. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh (DC.) Müll.Arg..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min50 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Habitat GIFTCampinarana, Floresta Ciliar ou Galeria, Floresta de Terra Firme, Floresta Estacional Perenifólia, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Savana Amazônica

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palicourea bracteocardia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF149367.1 ↗542 bp

ACGT

ACCAATGTGAACAAGTTAATAAATCGCGGGCTGCGGACGGGACGAGAGACACCTCCACCGTCAGCTCTCGCACCCAAATAAAACTCTCGG …

Psychotria bracteocardia internal transcribed spacer 1, partial sequence; and 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type307 records

Wild obs. + sensor101

Museum / vouchered206

Origin

Native112

Range

Area of Occupancy AOO864 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 28≤1 km 7≤10 km 9>10 km 7

51 georeferenced · 50 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Departamento de Sistematica e Ecologialocation not on record	42
University of Stellenboschlocation not on record	35
UFRPElocation not on record	32
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	18
JBRJlocation not on record	13
Universidad de la Amazonia (UniAmazonia)location not on record	7
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	6
Universidade Federal do Rio Grande do Nortelocation not on record	5
UFBAlocation not on record	5
St. Augustine, TT	5
Universidade Federal do Maranhãolocation not on record	5
UNICAMPlocation not on record	4
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Wlocation not on record	3
Chaguaramas, TT	2
Cuiabá, BR	2
UFPElocation not on record	2
Salvador, BR	2
Laboratorio de Ictiologialocation not on record	2
Institut fur Allgemeine Mikrobiologielocation not on record	1
CEPLAClocation not on record	1
UFPRlocation not on record	1
Ilhéus, BR	1
IPA/SPlocation not on record	1
UFMGlocation not on record	1
Cenargenlocation not on record	1
Masindi, UG	1
UEPAlocation not on record	1
Brasília, BR	1

29 institutions · 203 of 206 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Palicourea bracteocardia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)