Palaquium maingayi — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ericales/Sapotaceae/Palaquium

At a glance

Occurrence records64

Data sources6

Biological traits14

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Palaquium maingayi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF64 records

DNA & barcodingNCBIsequences

01Narrative

Pokok Nyatoh Tembaga merupakan sejenis tumbuhan yang terdapat di hutan Malaysia serta di negara-negara ASEAN yang lain. Nama botaninya Palaquium maingayi (Clarke) K. et G.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height25 m

Plant height max30 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density600 mg/cm³

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palaquium maingayi has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF686272.1 ↗686 bpMalaysia

ACGT

CGGAAGGATCATTGTCGAAATCTGCTGAACAGAACAACCTGTGAACCAGTATTATAGCAACCACCGGGGGTCCTTGTGGCGGGCGGGCGG …

Palaquium maingayi voucher Wilkie 846 (E) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor57

Museum / vouchered7

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 57

57 georeferenced

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edinburgh, GB	2
Saint Louis, US	1

2 institutions · 3 of 7 vouchered records shown · 4 without an institution code