Palafoxia integrifolia

(Nutt.) Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Palafoxia

At a glance

Occurrence records942

Data sources7

Biological traits8

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Palafoxia integrifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility942 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF942 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Palafoxia integrifolia, commonly known as the coastalplain palafox and coastal plain palafox, is a species of palafox native to the southeastern United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palafoxia integrifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY627452.1 ↗561 bp

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAGGATACT …

Palafoxia integrifolia voucher FLAS:Whitten 4008 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Palafoxia integrifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · eflora

CCDB · eflora

n 101×CCDB · book-ipcn65

CCDB · book-ipcn65 — Smith 1965a

n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Turner, B. L. & M. I. Morris. 1976. Systematics of Palafoxia (Asteraceae: Helenicae). Rhodora 78: 567–628.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type942 records

Wild obs. + sensor734

Museum / vouchered208

Range

Area of Occupancy AOO2 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 413≤1 km 81≤10 km 19>10 km 52

565 georeferenced · 169 without coordinates

Open the mapobservation + sensor734

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 5≤10 km 11>10 km 47

63 georeferenced · 145 without coordinates

Open the institutions mapphysical evidence208

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	59
Miami, US	48
Jena Microbial Resource Collectionlocation not on record	46
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	13
Valdosta State Universitylocation not on record	11
Chapel Hill, US	4
GAlocation not on record	3
Bloomington, US	3
San Angelo, US	2
Tall Timbers Research Stationlocation not on record	2
Saint Louis, US	2
Pullman, US	2
Dover, US	2
BAYLUlocation not on record	2
Bronx, US	1
Wuzhou, CN	1
EL PASO, US	1
Provo, US	1
Dekalb, US	1
Columbia, US	1
Chongqing Museumlocation not on record	1
Bangkok, TH	1

22 institutions · 207 of 208 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)