Palafoxia feayi

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Palafoxia

At a glance

Occurrence records1 618

Data sources9

Biological traits3

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Palafoxia feayi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 618 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF1 618 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Palafoxia feayi là một loài thực vật có hoa trong họ Cúc. Loài này được A.Gray mô tả khoa học đầu tiên năm 1877.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Habitat & environment2

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Palafoxia feayi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP972318.1 ↗636 bpUSA

ACGT

TCGAATCCTGCACAGCAGAACAACCCGCGAACATGTACCAACACTCGTGGCTTTGCGGGGCCCGACCCCGTGAAGCCTTGCCGGCGTCTG …

Palafoxia feayi voucher Merello 563 TEX/LL internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Palafoxia feayi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · eflora

CCDB · eflora

n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Turner, B. L. & M. I. Morris. 1976. Systematics of Palafoxia (Asteraceae: Helenicae). Rhodora 78: 567–628.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 618 records

Wild obs. + sensor1 472

Museum / vouchered146

Range

Area of Occupancy AOO1 964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 881≤1 km 152≤10 km 38>10 km 96

1 167 georeferenced · 305 without coordinates

Open the mapobservation + sensor1 472

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 4≤10 km 3>10 km 22

29 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	63
Miami, US	24
Jena Microbial Resource Collectionlocation not on record	14
University of Stellenboschlocation not on record	10
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
Bronx, US	5
Saint Louis, US	4
Chapel Hill, US	3
Bangkok, TH	3
Stockholm, SE	1
Mississippi State, US	1
Chadron, US	1
Tall Timbers Research Stationlocation not on record	1
Moscow, US	1
Canadian Department of Agriculturelocation not on record	1
Burlington, US	1
Dover, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
BAYLUlocation not on record	1

19 institutions · 143 of 146 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Palafoxia feayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 21.8–21.8

Seasonal swing summer↔winter12.3 °C

Max temp (day)26.8 °C

Min temp (night)17.9 °C

Precipitation115 mm/mo

Air humidity60.3 %

Moisture balance-4.90 mm/mo

Vapour deficit1,050 Pa

Wind speed2.60 m/s

Cloud cover34.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Palafoxia feayi

At a glance

Sources9 archives

Life cycle & reproduction1

Habitat & environment2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 618 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 618 records