Pajanelia longifolia

(Willd.) K.Schum. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Pajanelia

At a glance

Occurrence records68

Data sources11

Biological traits21

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Pajanelia longifolia's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS92 compounds

Occurrence & distributionGBIF68 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

Pajanelia, sometimes known in English as tender wild jack or pajanelia, in Malayalam as azhantha or pajneli, in Kannada as alangi and in Tamil as aranthal, is a monotypic genus of evergreen or briefly deciduous flowering tree in the family Bignoniaceae which contains a single species, Pajanelia longifolia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height36 m

Plant height max36 m

Life cycle & reproduction6

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromebat

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry5

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density300 mg/cm³

⚠ sources differ — TRY: 300 mg/cm³ · GIFT: 716 mg/cm³

Wood density max716 mg/cm³

Wood density min716 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition92 compounds

Compounds documented for Pajanelia longifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones11

Simple coumarins10

Cinnamic acids and derivatives9

Furofuranoid lignans8

Coumarinolignans6

Documented compounds92 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Neoolivil	present	NPASS
(+)-Secoisolariciresinol	present	NPASS
(-)-Lariciresinol	present	NPASS
(-)-Medioresinol	present	NPASS
(-)-Pinoresinol	present	NPASS
(-)-pinoresinol-4,4'-di-O-beta-D-glucopyranoside	present	NPASS
(-)-Syringaresinol	present	NPASS
(1S,2S)-2-{2-methoxy-4-[(1E)-prop-1-en-1-yl]phenoxy}-1-(3,4,5-trimethoxyphenyl)propan-1-ol	present	NPASS
(2R)-1,2-bis(3,4-dihydroxyphenyl)-3-hydroxypropan-1-one	present	NPASS
(2R,3R)-2-(hydroxymethyl)-3-[3-methoxy-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-2,3-dihydropyrano[3,2-h][1,4]benzodioxin-9-one	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pajanelia longifolia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKON622472.1 ↗447 bp

ACGT

ATTACTCCAAAGAAAGCCAGTTCCTCTTTTTCAAAAAGAAATCAAAGATTATTCTTATTCTTATATAATTCTCATGTATGTGAATATGAA …

Pajanelia longifolia maturase K gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pajanelia longifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Venkatasubban, K.R. 1944

CCDB · book-fedorov — Venkatasubban 1944

CCDB · book-atlas-flowering-plants — Venkatasubban 1944

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type68 records

Wild obs. + sensor46

Museum / vouchered22

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 28≤1 km 5≤10 km 3

36 georeferenced · 10 without coordinates

Open the mapobservation + sensor46

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 22 records without

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	6
Kew, GB	1
Saint Louis, US	1

3 institutions · 8 of 22 vouchered records shown · 14 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)