Pachypterus atherinoides

(Bloch, 1794) · species

image placeholder — illustration coming later

Animalia/Chordata/Siluriformes/Schilbeidae/Pachypterus

At a glance

Occurrence records57

Data sources8

Biological traits6

DNA specimens67

eDNA detections79

Sources8 archives

Databases and archives Pachypterus atherinoides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 records↗

OBISOcean Biodiversity Information System13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics67 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS57 records

Environmental DNA1 datasets · 2 countries79 detections

DNA & barcodingBOLD67 specimens

01Narrative

Neotropius atherinoides is een straalvinnige vissensoort uit de familie van glasmeervallen (Schilbeidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1794 door Bloch. De soort staat op de Rode Lijst van de IUCN als niet bedreigd, beoordelingsjaar 2009.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length15 cm

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits1

Vulnerability10

05DNA & barcoding67 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachypterus atherinoides has left across the world's sequence archives.

At a glance

DNA specimens67

BINs2

Marker genes1

eDNA detections79

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus67 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

2Cmostly conserved

33Tmostly conserved

36Cmostly conserved

41Cmostly conserved

62Cmostly conserved

65Cmostly conserved

86Amostly conserved

104Amostly conserved

107Cmostly conserved

110Cmostly conserved

131Cmostly conserved

134Tmostly conserved

138Gmostly conserved

149Tmostly conserved

158Amostly conserved

161Cmostly conserved

183Cmostly conserved

191Tmostly conserved

203Cmostly conserved

215Amostly conserved

283Tmostly conserved

289Cmostly conserved

290Gvariable

293Gmostly conserved

320Cmostly conserved

398Avariable

443Avariable

458Cvariable

495Tmostly conserved

602Gmostly conserved

608Amostly conserved

613Cmostly conserved

617Tmostly conserved

621Tmostly conserved

623Tmostly conserved

627Cmostly conserved

628Amostly conserved

629Cmostly conserved

CCTGAGCCGGAATAGTTGGTACAGCTCTTAGCTTACTAATCCGGGCAGAACTAGCCCAACCCGGCGCCCTCCTAGGCGATGATCAAATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes17

BINs2

Most divergent pair6.5%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachypterus khavalchorsame genus10.2%Hemibagrus menodasame order10.8%Hemibagrus punctatussame order10.9%Hemibagrus maydellisame order11.1%Hemibagrus pluriradiatussame order11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor5

Museum / vouchered52

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 4

9 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
FishBaselocation not on record	2
Cambridge, US	1
Vancouver, CA	1
CASlocation not on record	1

4 institutions · 5 of 52 vouchered records shown · 35 without an institution code

09Environmental DNA79 detections

Where the DNA of Pachypterus atherinoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 18.5–29.0

Seasonal swing summer↔winter10.6 °C

Max temp (day)30.0 °C 24.4–31.6

Min temp (night)18.8 °C 12.6–25.7

Precipitation37.3 mm/mo 12.7–250

Air humidity59.8 % 53.9–64.3

Moisture balance-60.1 mm/mo -106–117

Vapour deficit1,307 Pa 819–1,581

Wind speed2.20 m/s 1.20–3.80

Cloud cover34.6 % 11.6–58.6

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)