Pachypsylla celtidismamma

(Riley, 1881) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Aphalaridae/Pachypsylla

At a glance

Occurrence records7 434

Data sources7

Biological traits0

DNA specimens20

eDNA detections20

Sources7 archives

Databases and archives Pachypsylla celtidismamma's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility7 434 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 434 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD20 specimens

01Narrative

Pachypsylla celtidismamma, known generally as the hackberry nipplegall maker or hackberry psylla, is a species of plant-parasitic hemipteran in the family Aphalaridae. Galls on hackberry Hackberry nipplegall maker, Pachypsylla celtidismamma Hackberry nipplegall maker, Pachypsylla celtidismamma

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachypsylla celtidismamma has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections20

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

23Amostly conserved

24Tmostly conserved

34Amostly conserved

35Tmostly conserved

37Amostly conserved

76Amostly conserved

97Cmostly conserved

199Tmostly conserved

232Gmostly conserved

244Amostly conserved

251Tmostly conserved

278Cmostly conserved

280Gmostly conserved

283Cmostly conserved

319Amostly conserved

337Amostly conserved

340Tmostly conserved

343Tmostly conserved

346Amostly conserved

361Cmostly conserved

367Tmostly conserved

382Amostly conserved

388Amostly conserved

409Amostly conserved

418Cmostly conserved

421Gmostly conserved

424Cmostly conserved

433Cmostly conserved

451Tmostly conserved

460Tmostly conserved

469Gmostly conserved

472Cmostly conserved

487Cmostly conserved

508Tvariable

518Cmostly conserved

523Tmostly conserved

532Cmostly conserved

550Gmostly conserved

559Amostly conserved

562Tmostly conserved

571Tmostly conserved

574Cmostly conserved

589Tmostly conserved

646Tvariable

655Amostly conserved

TACATTATATTTTATTTTTGGAATTTGGTCAGGATTAATTGGACTATCACTAAGAATAATTATTCGTATTGAATTAAGACAATCATTATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachypsylla cohabitanssame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 434 records

Wild obs. + sensor7 382

Museum / vouchered52

Range

Area of Occupancy AOO16 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 4 572≤1 km 644≤10 km 220>10 km 385

5 821 georeferenced · 1 561 without coordinates

Open the mapobservation + sensor7 382

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	51
Catholic University of Pekinglocation not on record	1

2 institutions · 52 of 52 vouchered records shown

09Environmental DNA20 detections

Where the DNA of Pachypsylla celtidismamma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.4 °C 7.50–20.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)25.7 °C 12.9–25.7

Min temp (night)16.1 °C 2.60–16.1

Precipitation92.0 mm/mo 80.7–92.0

Air humidity57.6 % 55.5–57.8

Moisture balance-67.9 mm/mo -67.9–-12.5

Vapour deficit1,015 Pa 460–1,015

Wind speed3.70 m/s 3.60–4.70

Cloud cover38.8 % 38.8–46.9

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pachypsylla celtidismamma

At a glance

Sources7 archives

At a glance

Record type7 434 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 2 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 434 records