Pachypanchax sparksorum

Loiselle, 2006 · species

image placeholder — illustration coming later

Animalia/Chordata/Cyprinodontiformes/Aplocheilidae/Pachypanchax

At a glance

Occurrence records27

Data sources9

Biological traits4

DNA specimens20

eDNA detections4

Sources9 archives

Databases and archives Pachypanchax sparksorum's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD20 specimens

01Narrative

Pachypanchax sparksorum is a species of Aplocheilid killifish endemic to Madagascar where it is found in the Anjingo River and streams feeding into the Ankofia River. Its natural habitat is rivers. The specific name of this fish honours the ichthyologist John S. Sparks of the United States National Museum and his wife Karen Riseng Sparks, they collected many of the type series.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length5.53 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachypanchax sparksorum has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P498 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

165Tmostly conserved

168Cmostly conserved

198Tmostly conserved

303Amostly conserved

366Tmostly conserved

411Tmostly conserved

459Cmostly conserved

AATGTAATCGTTACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGTGGTTTTGGCAACTGATTAGTGCCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes4

BIN1

Most divergent pair1.6%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachypanchax arnoultisame genus2.6%Pachypanchax varatrazasame genus4.0%Pachypanchax patriciaesame genus4.0%Pachypanchax sakaramyisame genus4.2%Pachypanchax omalonotussame genus4.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type27 records

Museum / vouchered27

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 27 records without

Open the institutions mapphysical evidence27

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
	2
Ann Arbor, US	1

2 institutions · 3 of 27 vouchered records shown · 20 without an institution code

09Environmental DNA4 detections

Where the DNA of Pachypanchax sparksorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 27.0–27.0

Seasonal swing summer↔winter3.80 °C

Max temp (day)31.5 °C

Min temp (night)22.5 °C

Precipitation124 mm/mo

Air humidity56.2 %

Moisture balance-42.8 mm/mo

Vapour deficit1,552 Pa

Wind speed2.90 m/s

Cloud cover24.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)