Pachycereus weberi

(J.M.Coult.) Backeb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pachycereus

At a glance

Occurrence records501

Data sources12

Biological traits9

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Pachycereus weberi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility501 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS · NPASS178 compounds

Occurrence & distributionGBIF501 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceTreeOfSex2n = 22

01Narrative

Pachycereus weberi ist eine Pflanzenart aus der Gattung der Pachycereen in der Familie der Kakteengewächse (Cactaceae). Das Artepitheton weberi ehrt den Mediziner und Botaniker Frédéric Albert Constantin Weber. Spanische Trivialnamen sind „Candelabro“, „Cardón“ und „Chico“.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.81 mg

Seed mass max4.68 mg

Seed mass min4.68 mg

Life cycle & reproduction2

Life formsucculent tree

Life spanperennial

Habitat & environment3

Climateseasonally dry tropical

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition178 compounds

Compounds documented for Pachycereus weberi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Friedelane triterpenoids14

Lupane triterpenoids13

Megastigmanes10

Oleanane triterpenoids9

Isoquinoline alkaloids9

Documented compounds178 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-8-Methoxyisolariciresinol	present	NPASS
(+)-Abscisic acid beta-D-glucopyranosyl ester	present	NPASS
(+)-Erythrodiol	present	NPASS
(+)-Lyoniresinol	present	NPASS
(+)-Pellotine	present	LOTUS
(+)-Ursolic Acid	present	NPASS
(-)-Isolariciresinol	present	NPASS
(-)-Pellotine	present	LOTUS
(1R,2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bS)-1,2,4a,6a,6b,9,9,12a-octamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-hexadecahydropicene-2,10-diol	present	NPASS
(1R,3aR,5aR,5bR,7aR,11aR,11bR,13aR,13bR)-1-[(2R)-1-hydroxypropan-2-yl]-3a,5a,5b,8,8,11a-hexamethyl-2,3,4,5,6,7,7a,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysen-9-one	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachycereus weberi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF328666.1 ↗325 bp

ACGT

ATGCAGGGAGGCGTGCCTCGGTGCCCTCTCTAAGCCGGGAGCTACCCCTGGTGCAGCAATGAAATCACGACGCGGACCGCAGCAAAGAAC …

Pachycereus weberi internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

06Genome at a glanceTreeOfSex

The complete instruction manual Pachycereus weberi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 111×TreeOfSex · plant

TreeOfSex · plant — Arias2009 ↗

08Occurrence & distribution

Record type501 records

Wild obs. + sensor421

Museum / vouchered79

Other1

Range

Area of Occupancy AOO1 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 171≤1 km 53≤10 km 51>10 km 19

294 georeferenced · 127 without coordinates

Open the mapobservation + sensor421

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 56≤10 km 3>10 km 1

60 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	40
Tlalnepantla, MX	8
Bronx, US	4
University of Stellenboschlocation not on record	4
Chapingo, MX	1
Centro Cultural Santo Domingolocation not on record	1
Phoenix, US	1
Saint Louis, US	1
Mexico City, MX	1

9 institutions · 61 of 79 vouchered records shown · 17 without an institution code

09Environmental DNA1 detections

Where the DNA of Pachycereus weberi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)