Pachliopta hector

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Pachliopta

At a glance

Occurrence records1 986

Data sources8

Biological traits0

DNA specimens13

eDNA detections15

Sources8 archives

Databases and archives Pachliopta hector's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 986 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 986 records

Environmental DNA1 datasets · 3 countries15 detections

DNA & barcodingBOLD13 specimens

01Narrative

Male in Hyderabad, India Pachliopta hector, the crimson rose, is a large swallowtail butterfly belonging to the genus Pachliopta (roses) of the red-bodied swallowtails. It is recorded as a species of "Least Concern (LC)" by IUCN.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachliopta hector has left across the world's sequence archives.

At a glance

DNA specimens13

BINs3

Marker genes1

eDNA detections15

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Diversity (π)3.4%

Haplotypes2

BINs3

Most divergent pair0.61%

Where individuals differ — all 100 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

4Amostly conserved

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

14Amostly conserved

15Tmostly conserved

20Gmostly conserved

22Avariable

29Gmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Amostly conserved

35Amostly conserved

38Amostly conserved

40Tmostly conserved

43Tmostly conserved

49Amostly conserved

55Amostly conserved

59Tmostly conserved

67Tmostly conserved

70Tmostly conserved

79Amostly conserved

88Tmostly conserved

127Tmostly conserved

130Amostly conserved

139Amostly conserved

169Amostly conserved

190Tmostly conserved

202Cmostly conserved

212Tmostly conserved

214Amostly conserved

220Cmostly conserved

232Tmostly conserved

256Tmostly conserved

263Cmostly conserved

265Tmostly conserved

268Amostly conserved

274Cmostly conserved

277Amostly conserved

282Cmostly conserved

283Cmostly conserved

286Gmostly conserved

304Cmostly conserved

307Tmostly conserved

319Tmostly conserved

340Cmostly conserved

346Tmostly conserved

352Tmostly conserved

361Tmostly conserved

364Amostly conserved

368Amostly conserved

391Tmostly conserved

400Tmostly conserved

403Tmostly conserved

415Amostly conserved

428Cmostly conserved

430Tmostly conserved

436Amostly conserved

454Amostly conserved

469Tmostly conserved

470Amostly conserved

473Amostly conserved

474Amostly conserved

478Tmostly conserved

482Tmostly conserved

484Amostly conserved

508Tmostly conserved

514Amostly conserved

517Amostly conserved

520Tmostly conserved

526Amostly conserved

529Tmostly conserved

533Cmostly conserved

535Tmostly conserved

536Cmostly conserved

538Cmostly conserved

539Cmostly conserved

542Cmostly conserved

544Tmostly conserved

548Cmostly conserved

550Tmostly conserved

553Tmostly conserved

556Tmostly conserved

558Tmostly conserved

559Amostly conserved

562Tmostly conserved

578Tmostly conserved

580Amostly conserved

586Amostly conserved

600Amostly conserved

619Tmostly conserved

629Gmostly conserved

634Cmostly conserved

637Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGTACTTCATTAAGATTATTAATTCGTACTGAATTAGGAAATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachliopta aristolochiaesame genus3.5%Losaria coonsame family7.3%Byasa dasaradasame family7.6%Catocala similissame order8.1%Catocala jairsame order8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 986 records

Wild obs. + sensor1 953

Museum / vouchered33

Range

Area of Occupancy AOO4 296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 494≤1 km 687≤10 km 218>10 km 107

1 506 georeferenced · 447 without coordinates

Open the mapobservation + sensor1 953

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 3≤10 km 10>10 km 6

20 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	15
Cleveland Museum of Natural History, OH (CLEV)location not on record	8
Durban Natural Science Museumlocation not on record	2
Denver, US	2
MZLUlocation not on record	2
Tartu, EE	1

6 institutions · 30 of 33 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Pachliopta hector was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map3 countries0

TerrestrialNerium oleander

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 23.1–27.3

Seasonal swing summer↔winter6.10 °C

Max temp (day)30.2 °C 25.1–31.0

Min temp (night)19.9 °C 18.2–24.7

Precipitation58.3 mm/mo 37.5–151

Air humidity59.0 % 52.0–63.7

Moisture balance-17.8 mm/mo

Vapour deficit1,376 Pa 990–1,616

Wind speed2.20 m/s

Cloud cover25.2 % 16.8–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pachliopta hector

At a glance

Sources8 archives

At a glance

Record type1 986 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 986 records