Pachira sessilis

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Pachira

At a glance

Occurrence records133

Data sources6

Biological traits30

DNA specimens1

eDNA detections0

Sources6 archives

Databases and archives Pachira sessilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility133 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF133 records

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pachira sessilis là một loài thực vật có hoa trong họ Cẩm quỳ. Loài này được Benth. mô tả khoa học đầu tiên năm 1844.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Plant height22 m

⚠ sources differ — GIFT: 22 m · TRY: 10.8 m

Plant height max24 m

Seed length max15 mm

Seed length min6 mm

Seed mass301 mg

⚠ sources differ — TRY: 301 mg · GIFT: 328 mg

Seed mass max462 mg

Seed mass min221 mg

Life cycle & reproduction6

Deciduousnessdeciduous

Dispersal typewind

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndrome detailedbat

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry8

Ldmc max372 mg/g

Ldmc min372 mg/g

Leaf dry-matter content (LDMC)329 mg/g

⚠ sources differ — TRY: 329 mg/g · GIFT: 372 mg/g

Leaf n23.54 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)23.9 mm²/mg

Wood density474 mg/cm³

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pachira sessilis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMZ478905.1 ↗460 bpPanama

ACGT

TACTCCTGAATATGAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAGCAGGGGC …

Pachira sessilis voucher K1351_E5 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type133 records

Wild obs. + sensor27

Museum / vouchered106

Origin

Native11

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 8≤10 km 2>10 km 4

18 georeferenced · 9 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 2≤10 km 13

15 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	55
Universidad Tecnológica del Chocó (UTCH)location not on record	11
Kew, GB	6
MAlocation not on record	4
Universidad de Antioquia (UdeA)location not on record	4
ASUlocation not on record	4
University of Stellenboschlocation not on record	3
San José, CR	3
Bronx, US	2
COLlocation not on record	2
Fort Worth, US	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
HUAlocation not on record	1
Mexico City, MX	1
Chicago, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record	1
SCZlocation not on record	1

18 institutions · 103 of 106 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)