Pabstiella fusca

(Lindl.) Chiron & Xim.Bols. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Pabstiella

At a glance

Occurrence records242

Data sources7

Biological traits12

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Pabstiella fusca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility242 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF242 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pabstiella fusca is a species of perennial herb in the family Orchidaceae. The species is both epiphytic and cespitosic. The species is native to southern parts of Brazil. It can be found in São Paulo, Rio Grande Do Sul, Santa Catarina, Cerrado, Bahia, Espirito Santo, Rio de Janeiro, Paraná, Minas Gerais, as well as the Atlantic Forest. Pabstiella fusca lives on trees at an altitude of 1200 m located in forests with humid climates as well as trees that are deciduous.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pabstiella fusca has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK294814.1 ↗626 bp

ACGT

TCGAGACCGAAATATATCGAGCGATTCGGAGAACCTGTAAATGAGCAATGGCACTCGCCGTTGCGTGACATCCGTCCCCGTCGTCGGCCT …

Pabstiella fusca internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type242 records

Wild obs. + sensor10

Museum / vouchered232

Origin

Native141

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 3≤1 km 3≤10 km 1>10 km 2

9 georeferenced · 1 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 232 records without

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	133
INMAlocation not on record	25
JBRJlocation not on record	9
UNICAMPlocation not on record	7
Ivano-Frankivsk, UA	6
UFPRlocation not on record	6
UNESP-RClocation not on record	5
San Jose State University, Museum of Birds and Mammalslocation not on record	5
UNIVILLElocation not on record	4
CEPLAClocation not on record	4
Pontifícia Universidade Católica do Paranálocation not on record	3
UFABClocation not on record	3
ESALQlocation not on record	2
Universidade de São Paulolocation not on record	2
Pontifícia Universidade Católica do Paranálocation not on record	2
IPA/SPlocation not on record	2
UFMGlocation not on record	2
VALElocation not on record	2
UERJlocation not on record	1
Criciúma, BR	1
UFSCarlocation not on record	1
UNESClocation not on record	1
UTFPR-SLlocation not on record	1
Alicante, ES	1
UNESP-FCAlocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1

26 institutions · 230 of 232 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Pabstiella fusca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)