Ozothamnus thyrsoideus

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records1 669

Data sources8

Biological traits33

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Ozothamnus thyrsoideus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 669 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF1 669 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ozothamnus thyrsoideus, commonly known as sticky everlasting, is a flowering shrub, endemic to south-eastern Australia. It grows to between 0.5 and 2 metres in height. Leaves are 15 to 30 mm long and 1.5 to 2 mm wide. Flowerheads appear in terminal corymbs in the summer. The species was formally described in 1838 by Swiss botanist Augustin Pyramus de Candolle, based on plant material collected in Tasmania. It occurs in subalpine areas of New South Wales, the Australian Capital Territory, Victoria and Tasmania.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology13

Fruit length1.5 mm

Leaf length30 mm

Leaf size118 mm²

Leaf width2 mm

Leaf width max30 mm

Leaf width min15 mm

Petiole length0.175 cm

Plant height3 m

Plant height max3 m

Plant height min0.5 m

Seed mass0.128 mg

⚠ sources differ — TRY: 0.128 mg · AusTraits: 0.129 mg · GIFT: 0.12 mg

Seed mass max0.12 mg

Seed mass min0.12 mg

Life cycle & reproduction6

Dispersal typewind

Flowering timeyynnnnnnnnyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear oblong

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus thyrsoideus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956615.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCATAGCAGAACGACCCGTGAACATGTAACTACTACTGGGC …

Ozothamnus thyrsoideus isolate ASL371 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 669 records

Wild obs. + sensor1 054

Museum / vouchered613

Cultivated / captive2

Origin

Native90

Introduced1

Range

Area of Occupancy AOO4 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 624≤1 km 196≤10 km 157>10 km 11

988 georeferenced · 66 without coordinates

Open the mapobservation + sensor1 054

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 39≤1 km 260≤10 km 233>10 km 29

561 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence613

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	161
Museo Entomologico de Leonlocation not on record	135
Hobart, AU	109
Mount Annan, AU	91
Adelaide, AU	38
QVMAGlocation not on record	19
Brisbane, AU	12
Palmerston, AU	6
Parkville, AU	5
Armidale, AU	5
La Trobe Universitylocation not on record	4
Kew, GB	4
Stockholm, SE	3
Kensington, AU	3
Honolulu, US	3
John T. Waterhouse Herbariumlocation not on record	2
CJBGlocation not on record	2
Auckland, NZ	2
Wellington, NZ	2
Batemans Bay, AU	2
University of Stellenboschlocation not on record	1
MAlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Cambridge University Herbariumlocation not on record	1
EL PASO, US	1

25 institutions · 613 of 613 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Ozothamnus thyrsoideus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ozothamnus thyrsoideus

At a glance

Sources8 archives

Size & morphology13

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 669 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 669 records