Ozothamnus stirlingii

(F.Muell.) Anderb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records517

Data sources9

Biological traits32

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Ozothamnus stirlingii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility517 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionLOTUS · NPASS30 compounds

Occurrence & distributionGBIF517 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ozothamnus stirlingii là một loài thực vật có hoa trong họ Cúc. Loài này được (F.Muell.) Anderb. mô tả khoa học đầu tiên năm 1991.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology13

Fruit length1.5 mm

Leaf length80 mm

Leaf length max80 mm

Leaf length min65 mm

Leaf width13 mm

Leaf width max13 mm

Leaf width min10 mm

Petiole length0.6 cm

Plant height2 m

Plant height max3 m

Seed mass0.251 mg

Seed mass max0.25 mg

Seed mass min0.25 mg

Life cycle & reproduction6

Dispersal typewind

Flowering timeyynnnnnnnnny

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition30 compounds

Compounds documented for Ozothamnus stirlingii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives9

Furocoumarins $ Simple coumarins5

Dihydroflavonols2

Lupane triterpenoids2

Cyclitols2

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Betulonic acid	present	LOTUS
(,6E)-3,7-Dimethyl-2,6-octadienyl cinnamate	present	LOTUS
(2S)-10-methoxy-2-prop-1-en-2-yl-2,3-dihydropyrano[2,3-g][1,4]benzodioxin-7-one	present	LOTUS
(2S)-2-(3-hydroxyprop-1-en-2-yl)-10-methoxy-2,3-dihydropyrano[2,3-g][1,4]benzodioxin-7-one	present	LOTUS
(2S)-2-(3-hydroxyprop-1-en-2-yl)-2,3-dihydropyrano[2,3-g][1,4]benzodioxin-7-one	present	LOTUS
(2S)-5-hydroxy-7-[4-[(1S)-1-hydroxyethyl]phenoxy]-2-phenyl-2,3-dihydrochromen-4-one	present	LOTUS
(2S)-pinocembrin	present	LOTUS
2,3-Dihydroxycinnamic acid	present	LOTUS
2-[(1R,3aR,5aR,5bR,7aR,11aR,11bR,13aR,13bR)-5a,5b,8,8,11a-pentamethyl-9-oxo-1-prop-1-en-2-yl-2,3,4,5,6,7,7a,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysen-3a-yl]acetic acid	present	LOTUS
2-[(2S)-10-methoxy-7-oxo-2,3-dihydropyrano[2,3-g][1,4]benzodioxin-2-yl]prop-2-enal	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus stirlingii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956605.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCATAGCAGAACGACCCGTGAACATGTAACTACTACCGGGC …

Ozothamnus stirlingii isolate ASL361 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type517 records

Wild obs. + sensor289

Museum / vouchered227

Cultivated / captive1

Origin

Native33

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 138≤1 km 51≤10 km 50>10 km 1

240 georeferenced · 49 without coordinates

Open the mapobservation + sensor289

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 14≤1 km 65≤10 km 106>10 km 22

207 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence227

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	72
Museo Entomologico de Leonlocation not on record	69
Mount Annan, AU	33
Adelaide, AU	15
Brisbane, AU	8
Hobart, AU	6
Parkville, AU	5
La Trobe Universitylocation not on record	5
Armidale, AU	5
Kew, GB	3
Kensington, AU	2
Stockholm, SE	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Christchurch, NZ	1
Palmerston, AU	1

15 institutions · 227 of 227 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Ozothamnus stirlingii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)