Ozothamnus scutellifolius

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records393

Data sources7

Biological traits18

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Ozothamnus scutellifolius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Chemical compositionLOTUS11 compounds

Occurrence & distributionGBIF393 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ozothamnus scutellifolius là một loài thực vật có hoa trong họ Cúc. Loài này được Hook.f. mô tả khoa học đầu tiên năm 1856.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf length1.5 mm

Leaf size1.77 mm²

Leaf width1.5 mm

Plant height1 m

Seed length0.785 mm

Seed mass0.041 mg

⚠ sources differ — TRY: 0.041 mg · AusTraits: 0.047 mg · GIFT: 0.04 mg

Seed mass max0.04 mg

Seed mass min0.04 mg

Seed width0.471 mm

Life cycle & reproduction4

Dispersal typewind

Life formsubshrub

Life spanperennial

Sex typehermaphrodite+monoecious

Habitat & environment5

Climatetemperate

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Woodinesswoody

03Chemical composition11 compounds

Compounds documented for Ozothamnus scutellifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols8

Kaurane and Phyllocladane diterpenoids $ Norkaurane diterpenoids1

Flavones1

Kaurane and Phyllocladane diterpenoids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
16-Hydroxykauran-18-al	present	LOTUS
3,5,4'-Trihydroxy-7,8-dimethoxyflavone	present	LOTUS
3,5,8-Trihydroxy-7-methoxyflavone	present	LOTUS
3,5-Dihydroxy-7,8-dimethoxyflavone	present	LOTUS
5,7,8-Trihydroxy-3-methoxyflavone	present	LOTUS
5-Hydroxy-3,7,8-trimethoxyflavone	present	LOTUS
8-Methoxygalangin	present	LOTUS
[(1S,4S,5R,9S,10R,13R,14R)-14-hydroxy-5,9,14-trimethyl-5-tetracyclo[11.2.1.01,10.04,9]hexadecanyl]methyl acetate	present	LOTUS
Herbacetin 3,8,4'-trimethyl ether	present	LOTUS
Quercetin 3-O-methyl-ether	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus scutellifolius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956601.1 ↗492 bp

ACGT

TAGGGAATACAGGATGTCACATTGGCACACTAACCATCCCCGGCACGGAATGTGCCAAGGAAATTCTAACTTAAAGAATTGGTGGTTTCT …

Ozothamnus scutellifolius isolate ASL357 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type393 records

Wild obs. + sensor270

Museum / vouchered123

Origin

Native4

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 135≤1 km 47≤10 km 47>10 km 5

234 georeferenced · 36 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤1 km 80≤10 km 32>10 km 1

113 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence123

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	81
Museo Entomologico de Leonlocation not on record	14
Canberra, AU	10
QVMAGlocation not on record	7
Mount Annan, AU	4
Adelaide, AU	2
Palmerston, AU	2
Kensington, AU	1
Brisbane, AU	1
Wlocation not on record	1

10 institutions · 123 of 123 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ozothamnus scutellifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)