Ozothamnus rufescens

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records423

Data sources7

Biological traits26

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Ozothamnus rufescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility423 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF423 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Ozothamnus rufescens is an Australian shrub in the family Asteraceae, native to the states of New South Wales and Queensland. Usually seen on the edges of rainforests, up to 4 metres in height. The southernmost point of its natural distribution is near Muswellbrook, New South Wales. This plant first appeared in scientific literature in the year 1838, in the Prodromus Systematis Naturalis Regni Vegetabilis authored by the Swiss botanist Augustin Pyramus de Candolle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Leaf length10.5 mm

Leaf length max17 mm

Leaf length min4 mm

Leaf width2.25 mm

Leaf width max3 mm

Leaf width min1.5 mm

Plant height4 m

Plant height max4 m

Seed length0.75 mm

Seed width0.75 mm

Life cycle & reproduction5

Flowering timennnnnnnnyyyn

Life spanperennial

Reproductive maturity5 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: climber

Leaf compoundnesssimple

Leaf shapeoblong ovate

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus rufescens has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895902.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCAGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATGAAACCAAGGATACTGATATCTTGGCAGC …

Ozothamnus rufescens voucher 129308277 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type423 records

Wild obs. + sensor246

Museum / vouchered173

Other4

Origin

Native47

Range

Area of Occupancy AOO1 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 220≤1 km 7≤10 km 4

231 georeferenced · 15 without coordinates

Open the mapobservation + sensor246

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 29≤1 km 32≤10 km 57>10 km 24

142 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence173

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	47
Brisbane, AU	41
Canberra, AU	23
Museo Entomologico de Leonlocation not on record	19
Armidale, AU	17
John T. Waterhouse Herbariumlocation not on record	6
Adelaide, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Kew, GB	3
Hobart, AU	1
Kensington, AU	1
Beijing, CN	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
University of Stellenboschlocation not on record	1
Honolulu, US	1
Palmerston, AU	1
BISHlocation not on record	1

17 institutions · 172 of 173 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Ozothamnus rufescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter11.6 °C

Max temp (day)21.3 °C

Min temp (night)11.0 °C

Precipitation91.4 mm/mo

Air humidity59.9 %

Moisture balance-14.6 mm/mo

Vapour deficit728 Pa

Wind speed1.80 m/s

Cloud cover23.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)