Ozothamnus rodwayi

Orchard · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records302

Data sources7

Biological traits17

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Ozothamnus rodwayi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility302 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF302 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ozothamnus rodwayi, commonly known as alpine everlastingbush (and formerly known as Helichrysum backhousiiWilson, P.G., Short, P.S. and Orchard, A.E., 1992. Some nomenclatural changes in the Angianthinae and Cassiniinae (Asteraceae: Gnaphalieae). Muelleria, 7(4), pp.519-524.), is a species of flowering plant in the family Asteraceae that is endemic to Tasmania, Australia. It is a widespread small, dense alpine shrub abundantly found in alpine and high subalpine heaths and woodlands. == Description

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology7

Leaf length12 mm

Leaf size11.31 mm²

Leaf width1.2 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 0.61 m

Seed mass0.27 mg

⚠ sources differ — AusTraits: 0.27 mg · GIFT: 0.24 mg

Seed mass max0.24 mg

Seed mass min0.24 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typewind

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Habitat & environment5

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus rodwayi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956646.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCTGGC …

Ozothamnus rodwayi isolate ASL540 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type302 records

Wild obs. + sensor152

Museum / vouchered149

Cultivated / captive1

Origin

Native22

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 79≤1 km 22≤10 km 22>10 km 2

125 georeferenced · 27 without coordinates

Open the mapobservation + sensor152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 6≤1 km 50≤10 km 39>10 km 6

101 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence149

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	35
Canberra, AU	28
Mount Annan, AU	22
QVMAGlocation not on record	22
Christchurch, NZ	18
Museo Entomologico de Leonlocation not on record	8
Brisbane, AU	6
Adelaide, AU	5
Kensington, AU	1
Kew, GB	1
Parkville, AU	1
Armidale, AU	1
Smithfield, AU	1

13 institutions · 149 of 149 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Ozothamnus rodwayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)