Ozothamnus lycopodioides

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records288

Data sources7

Biological traits15

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Ozothamnus lycopodioides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility288 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS14 compounds

Occurrence & distributionGBIF288 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ozothamnus lycopodioides là một loài thực vật có hoa trong họ Cúc. Loài này được Hook.f. mô tả khoa học đầu tiên năm 1847.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology7

Leaf length7 mm

Leaf size6.05 mm²

Leaf width1.1 mm

Plant height1 m

Seed mass0.071 mg

⚠ sources differ — TRY: 0.071 mg · AusTraits: 0.08 mg · GIFT: 0.07 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Life cycle & reproduction3

Dispersal typewind

Life spanperennial

Sex typehermaphrodite+monoecious

Habitat & environment5

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

03Chemical composition14 compounds

Compounds documented for Ozothamnus lycopodioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols8

Flavones4

Simple coumarins2

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
3,5,4'-Trihydroxy-7,8-dimethoxyflavone	present	LOTUS
3,5,8-Trihydroxy-7-methoxyflavone	present	LOTUS
3,5-Dihydroxy-7,8-dimethoxyflavone	present	LOTUS
5,6,7,8,3'-Pentamethoxy-4',5'-methylenedioxyflavone	present	LOTUS
5,7,8-Trihydroxy-3-methoxyflavone	present	LOTUS
5-Hydroxy-3,7,8-trimethoxyflavone	present	LOTUS
5-Hydroxy-6-methoxy-7-(3-methylbut-2-enoxy)chromen-2-one	present	LOTUS
7-(2,3-Dihydroxy-3-methylbutoxy)-5-hydroxy-6-methoxychromen-2-one	present	LOTUS
8-Methoxygalangin	present	LOTUS
Herbacetin 3,8,4'-trimethyl ether	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus lycopodioides has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956588.1 ↗724 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGGC …

Ozothamnus lycopodioides isolate ASL342 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type288 records

Wild obs. + sensor212

Museum / vouchered76

Origin

Native4

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 160≤1 km 21≤10 km 27>10 km 2

210 georeferenced · 2 without coordinates

Open the mapobservation + sensor212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 2≤1 km 46≤10 km 16>10 km 3

67 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	42
Canberra, AU	11
Museo Entomologico de Leonlocation not on record	9
QVMAGlocation not on record	7
Mount Annan, AU	4
Kensington, AU	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Adelaide, AU	1

8 institutions · 76 of 76 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ozothamnus lycopodioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)