Ozothamnus ledifolius

(A.Cunn. ex DC.) Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records533

Data sources9

Biological traits20

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Ozothamnus ledifolius's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility533 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS16 compounds

Occurrence & distributionGBIF533 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ozothamnus ledifolius is a shrub, from the family Asteraceae and one of 54 species from the genus Ozothamnus. Harold Frederick Comber (1897–1969), an English horticulturist and plant collector, introduced Ozothamnus ledifolius in 1929 on mountains of Tasmania above 2500 ft. high from the seeds collected from 4000 ft. height.Plant Lover's Companion: Plants, People and Places Brittain, J. (2006). Plants, People & Places: The Plant Lover's Companion. David & Charles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length15 mm

Leaf mass per area264 g/m2

Leaf size18.37 mm²

Leaf width1.5 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 0.273 m

Seed length1.1 mm

Seed mass0.358 mg

⚠ sources differ — TRY: 0.358 mg · AusTraits: 0.322 mg

Seed width0.393 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typewind

Life formsubshrub or shrub

Life spanperennial

Sex typehermaphrodite+monoecious

Habitat & environment6

Climatetemperate

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

⚠ sources differ — AusTraits: shrub · TRY: self

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry1

Wood density610 mg/cm³

03Chemical composition16 compounds

Compounds documented for Ozothamnus ledifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols8

Bisabolane sesquiterpenoids4

Lupane triterpenoids1

Kaurane and Phyllocladane diterpenoids1

Oleanane triterpenoids1

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4S,5S,9S,10R,13R,14R)-5-(hydroxymethyl)-5,9,14-trimethyltetracyclo[11.2.1.01,10.04,9]hexadecan-14-ol	present	LOTUS
(6R)-3-methyl-6-((2S)-6-methylhept-5-en-2-yl)cyclohex-2-en-1-one	present	LOTUS
(6S)-6-[(E,2R)-7-hydroxy-6-methylhept-5-en-2-yl]-3-methylcyclohex-2-en-1-one	present	LOTUS
3,5,4'-Trihydroxy-7,8-dimethoxyflavone	present	LOTUS
3,5,8-Trihydroxy-7-methoxyflavone	present	LOTUS
3,5-Dihydroxy-7,8-dimethoxyflavone	present	LOTUS
5,7,8-Trihydroxy-3-methoxyflavone	present	LOTUS
5-Hydroxy-3,7,8-trimethoxyflavone	present	LOTUS
8-Methoxygalangin	present	LOTUS
[(E,6R)-2-methyl-6-[(1S)-4-methyl-2-oxocyclohex-3-en-1-yl]hept-2-enyl] acetate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus ledifolius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJQ956586.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCCGGC …

Ozothamnus ledifolius isolate ASL340 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type533 records

Wild obs. + sensor376

Museum / vouchered156

Other1

Origin

Native21

Range

Area of Occupancy AOO360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 179≤1 km 62≤10 km 47>10 km 12

300 georeferenced · 76 without coordinates

Open the mapobservation + sensor376

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 15≤1 km 60≤10 km 64>10 km 9

148 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence156

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	54
Canberra, AU	39
Mount Annan, AU	21
Museo Entomologico de Leonlocation not on record	21
Adelaide, AU	7
Brisbane, AU	5
Armidale, AU	3
QVMAGlocation not on record	2
Davis, US	1
Kensington, AU	1
Christchurch, NZ	1
Cambridge University Herbariumlocation not on record	1

12 institutions · 156 of 156 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ozothamnus ledifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)