Ozothamnus cupressoides

Puttock & D.J.Ohlsén · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Ozothamnus

At a glance

Occurrence records894

Data sources6

Biological traits33

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Ozothamnus cupressoides's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility894 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Occurrence & distributionGBIF894 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Ozothamnus cupressoides is an aromatic shrub species, endemic to Australia. Common names include scaly everlasting, lattice everlasting or kerosene bush. It grows to between 0.5 and 1 metre in height and has white-tomentose branchlets. The scale-like leaves are 1 to 3 mm long and 0.5 to 1 mm wide. These are green on the upper surface, and white tomentose below. The flower heads appear in dense clusters in summer and autumn The species occurs in boggy sites and subalpine heathland in New South Wales and Victoria. It was first formally described in 2010 in the journal Muelleria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology13

Fruit length1.25 mm

Leaf length3 mm

Leaf length max3 mm

Leaf length min1 mm

Leaf mass per area174 g/m2

Leaf size12.47 mm²

⚠ sources differ — TRY: 12.47 mm² · AusTraits: 3.44 mm²

Leaf width0.9 mm

Leaf width max1 mm

Leaf width min0.5 mm

Plant height1.1 m

Plant height max1.2 m

Plant height min0.5 m

Seed mass0.171 mg

Life cycle & reproduction6

Dispersal typewind

Flowering timeyyynnnnnnnny

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate triangular

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)483 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.43 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ozothamnus cupressoides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJQ956579.1 ↗725 bp

ACGT

TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACTACCGGGC …

Ozothamnus cupressoides isolate ASL332 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

08Occurrence & distribution

Record type894 records

Wild obs. + sensor663

Museum / vouchered230

Cultivated / captive1

Origin

Native11

Range

Area of Occupancy AOO1 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 370≤1 km 106≤10 km 88>10 km 3

567 georeferenced · 96 without coordinates

Open the mapobservation + sensor663

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 42≤1 km 59≤10 km 97>10 km 12

210 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence230

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	103
Canberra, AU	91
Mount Annan, AU	10
Armidale, AU	6
Brisbane, AU	4
Parkville, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
John T. Waterhouse Herbariumlocation not on record	3
Stockholm, SE	2
La Trobe Universitylocation not on record	2
Kew, GB	1
Minia, EG	1

12 institutions · 230 of 230 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Ozothamnus cupressoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)