Oziroe arida

(Poepp.) Speta · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Oziroe

At a glance

Occurrence records428

Data sources6

Biological traits14

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Oziroe arida's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility428 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF428 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 34

01Narrative

Oziroe arida là một loài thực vật có hoa trong họ Măng tây. Loài này được (Poepp.) Speta mô tả khoa học đầu tiên năm 1998.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass4.51 mg

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max200 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oziroe arida has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ859624.1 ↗739 bpChile · 2024

ACGT

GAACAAGGTTTCTGTAGGTGAACCTGCGGAAGGATCATTGTGGAGGGCCGAAAGGGATTATTGTGAACCTGTCAACGAACCCGTTGGGGG …

Oziroe arida voucher EIF12921 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oziroe arida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Fernandez, A. & J. R. Davina. 1991. Heterochromatin and genome size in Fortunatia and Camassia (Hyacinthaceae). Kew Bull. 46: 307–316.

CCDB · kew — Fernandez A, Daviña, JR. 1991. Heterochromatin and genome size in Fortunatia and Camassia (Hyacinthaceae). Kew Bulletin 46: 307-316.

08Occurrence & distribution

Record type428 records

Wild obs. + sensor411

Museum / vouchered17

Range

Area of Occupancy AOO1 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 204≤1 km 53≤10 km 23>10 km 8

288 georeferenced · 123 without coordinates

Open the mapobservation + sensor411

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UChlocation not on record	13
Herbario Universidad de Concepciónlocation not on record	1
Berlin, DE	1
San Isidro, AR	1
PLAlocation not on record	1

5 institutions · 17 of 17 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)