Oxylobium ellipticum

(Vent.) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Oxylobium

At a glance

Occurrence records3 375

Data sources10

Biological traits41

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Oxylobium ellipticum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 375 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF3 375 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Oxylobium ellipticum, known as the common shaggy-pea is a common small plant in the pea family, found in south-eastern Australia. Pods with flowers.pods are usually grey brown , rounded ,covered with long silk hairs.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYWCVPGIFT

Size & morphology13

Fruit length8 mm

Leaf length30 mm

Leaf mass per area169 g/m2

Leaf size40.52 mm²

⚠ sources differ — TRY: 40.52 mm² · AusTraits: 80.24 mm²

Leaf width10 mm

Petiole length0.4 cm

Plant height2 m

⚠ sources differ — AusTraits: 2 m · TRY: 1.47 m

Plant height max2 m

Seed length2.5 mm

Seed mass3.92 mg

⚠ sources differ — TRY: 3.92 mg · AusTraits: 3.62 mg · GIFT: 3.87 mg

Seed mass max4.12 mg

Seed mass min3.38 mg

Seed width2.02 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timennnnnnnnyyyy

Life spanperennial

Lifespan years50 years

Pollination syndromeinsect

Reproductive maturity5 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapecordate elliptical lanceolate ovate

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio33.87 g/g

Leaf c497 mg/g

Leaf dry-matter content (LDMC)553 mg/g

Leaf n15.38 mg/g

Leaf p0.583 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.08 mm²/mg

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Oxylobium ellipticum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY015218.1 ↗566 bp

ACGT

CCGAGGGCAGGCTCGGGGGTGCTAGACACCTCAGACCTCTCTCGTGCCGGGAGGTGCTCTCCCCGTGAGGGTGCCATCCTAGCTGAACAC …

Oxylobium ellipticum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Oxylobium ellipticum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

n 82×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 375 records

Wild obs. + sensor2 502

Museum / vouchered844

Cultivated / captive26

Other3

Origin

Native172

Range

Area of Occupancy AOO6 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 497≤1 km 454≤10 km 157>10 km 55

2 163 georeferenced · 339 without coordinates

Open the mapobservation + sensor2 502

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 78≤1 km 277≤10 km 345>10 km 78

778 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence844

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 12

23 georeferenced · 3 without coordinates

Open the mapnot free-living26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	249
Hobart, AU	181
Mount Annan, AU	171
Museo Entomologico de Leonlocation not on record	115
Adelaide, AU	38
QVMAGlocation not on record	18
Armidale, AU	14
Brisbane, AU	11
Parkville, AU	7
John T. Waterhouse Herbariumlocation not on record	7
La Trobe Universitylocation not on record	7
Batemans Bay, AU	5
Smithfield, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Kew, GB	2
LDlocation not on record	2
South Kensington, GB	2
Wellington, NZ	1
MAlocation not on record	1
Wollongong, AU	1

20 institutions · 839 of 844 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Oxylobium ellipticum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Oxylobium ellipticum

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry8

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 375 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 375 records